Page 694

The market has failed to give Australians affordable housing, so don’t expect it to solve the crisis

Source: The Conversation (Au and NZ) – By Hal Pawson, Professor of Housing Research and Policy, and Associate Director, City Futures Research Centre, UNSW Sydney

The federal Labor government has promised to craft a national housing and homelessness plan and to fund new social housing, returning Canberra to a field it all but abandoned for a decade. A new Productivity Commission report is scathing about current arrangements and calls for far-reaching change.

Yet some of the report’s key recommendations rest on faulty assumptions and outdated economic thinking. It relies on a misplaced belief that the market will respond to low-income households’ need for affordable housing. Its faith in deregulation as a cure-all is misguided.

The experience of recent decades and a wealth of research evidence instead point to the need to increase government investment in public and community housing.




Read more:
Australia has been crying out for a national housing plan, and new council is a big step towards having one


Failed policies must change

The National Housing and Homelessness Agreement provides $1.6 billion a year in federal funding to the states and territories. It’s meant to improve Australians’ access to affordable and secure housing.

However, in its review of the agreement, the commission judges it ineffective and in need of a major shake-up.

With rents rising and vacancies falling, low-income private renters “are spending more on housing than they used to”. Some “have little income left after paying their rent”. Almost one in four have less than $36 a day for other essentials.

The supply of social housing – with rents capped at 25% of tenant income – has virtually halved in 30 years. Waiting lists have surged to 176,000 households. Many more are estimated to be in need.




Read more:
Australia needs to triple its social housing by 2036. This is the best way to do it


More people are seeking emergency housing support from homelessness services. And, as the report acknowledges, more are being turned away.

The commission declares “homelessness is a result of not being able to afford housing” and governments must “address the structural factors that lead to housing unaffordability”. As experts in housing policy, economics and urban planning, we agree. Far-reaching reform is long overdue.

The report concludes, for example, that first home-buyer grants and stamp duty concessions are counterproductive and push up prices. It advocates spending these billions on preventing homelessness instead.

The report endorses a “housing first” approach to tackling homelessness – this means housing people unconditionally as the first priority before dealing with their other needs. The report also calls for early intervention programs for “at risk” cohorts, such as people leaving hospitals, prisons or out-of-home care.

So what’s wrong with the report?

The review’s terms of reference, set by the previous government in 2021, meant the commission did not consider how easy credit, negative gearing and the capital gains tax discount drive real estate speculation, inflate prices and lead to inefficient use of housing and land. Coupled with the commission’s embedded faith in market forces, these omissions skew its recommendations, especially on social housing.

Instead of more public investment to provide more social housing, the commission urges Canberra to convert its $1.4 billion-a-year support for social housing running costs through the national agreement into Commonwealth Rent Assistance. It wants to up-end the current system by replacing income-based rents with market rents across social housing.

But most of these renters would be much worse off unless there is a large rent assistance increase across the board. Recognising this, the commission advocates a top-up payment “to ensure housing is affordable and tenancies can be sustained”. Without estimating the cost, it optimistically suggests the states should pick up the tab.

The commission argues this approach would be more equitable for social and private renters. The implicit subsidy from capping social housing tenants’ rents at 25% of income typically exceeds the rent assistance paid to private tenants. Yet reducing social housing tenants to the same level of precarity as private renters seems an odd way to eliminate unfairness.

Enabling low-income Australians to secure decent private rental homes would require a dramatic rise in rent assistance payments, perhaps even to a level equating to the implicit subsidy social housing tenants receive.

Broader benefits of social housing overlooked

The commission has neglected the broader benefits of social housing investment that delivers good-quality, well-managed homes that low-income earners can afford.

Decades of mounting rent assistance expenditure have failed to fill the gap created by the lack of a sustained national program of social housing construction since the 1990s. Research shows the shortfall in private dwellings affordable to low-income renters ballooned from 48,000 in 1996 to 212,00 in 2016.


CC BY



Read more:
Australia’s social housing system is critically stressed. Many eligible applicants simply give up


Simple comparisons between the costs of rent assistance and building affordable homes also ignore the wider community benefits of social housing. SGS Economics recently found the return on social housing investment is “comparable to, or better than” major infrastructure projects. And economics professor Andi Nygaard estimates the “large, but avoidable, annual social and economic costs” of the affordable housing shortage will top $1 billion a year by 2036.

Why planning reform is no panacea

Underlying much of the commission’s thinking is the idea that the main cause of unaffordable housing is outdated land-use planning rules that restrict new housing supply.

This contention ignores two decades of state planning reforms, including higher-density housing near transport and town centres, simplified rules and accelerated decision-making.

The commission estimates a 1% increase in overall housing supply (implicitly achievable through planning deregulation) could deflate rents by 2.5%. But what makes this scenario implausible is the development industry’s time-honoured – but entirely rational – practice of drip-feeding new housing supply to keep prices buoyant. Even if planning relaxation could enable ramped-up construction, it’s hard to imagine that being sustained in the face of any resulting market cooling.

However, the commission argues all private real estate development, regardless of cost, will eventually trickle through to those in need. As properties are traded over time, pricier homes will “filter down” through the market at progressively lower rents.

This view defies evidence that many factors other than planning have profound impacts on housing costs and supply. New Australian research strongly suggests “filtering” alone will not make homes affordable for lower-income earners.




Read more:
Affordable housing policy failure still being fuelled by flawed analysis


None of this is to deny that the planning system could be improved. But if solving housing unaffordability were simply a case of “unleashing planning reforms”, other countries would have managed it long ago.

Australians struggling to pay the rent, or even find a home, deserve a much better response from Australia’s premier economic policy agency, and one that actually reflects the dynamics of the housing system.

The Conversation

Hal Pawson receives funding from the Australian Housing and Urban Research Institute, the Australian Research Council, Launch Housing, Queensland Council of Social Service and Crisis UK.

Bill Randolph currently receives funding from the Australian Research Council.

Chris Leishman receives funding from the Australian Housing and Urban Research Institute (AHURI), the Economic and Social Research Council (UK-ESRC), Australian and UK state government departments, the National Housing Finance and Investment Corporation (NHFIC). He is affiliated with Housing Choices Australia Ltd, as a non-executive director, and the Urban Studies Journal (for which he is an editor).

Nicole Gurran receives funding from the Australian Housing & Research Institute and the Australian Research Council.

Peter Phibbs receives funding from Shelter Tasmania

Vivienne Milligan receives funding from the Australian Housing and Urban Research Institute Ltd. She is affiliated with Community Housing Industry Association of Australia.

Peter Mares does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.

ref. The market has failed to give Australians affordable housing, so don’t expect it to solve the crisis – https://theconversation.com/the-market-has-failed-to-give-australians-affordable-housing-so-dont-expect-it-to-solve-the-crisis-192177

Problems conceiving are not just about women. Male infertility is behind 1 in 3 IVF cycles

Source: The Conversation (Au and NZ) – By Karin Hammarberg, Senior Research Fellow, Global and Women’s Health, School of Public Health & Preventive Medicine, Monash University

Shutterstock

For the first time, IVF clinics in Australia and New Zealand have reported data about the scale and range of male fertility problems in couples who have IVF. New data released by the Australia and New Zealand Assisted Reproduction Database (ANZARD) today reveal about one-third of all IVF cycles performed in 2020 included a diagnosis of male infertility.

Although most male fertility problems can’t be prevented, there are things men can do to improve sperm quality and the chance of natural conception.




Read more:
Fertility miracle or fake news? Understanding which IVF ‘add-ons’ really work


What causes male infertility?

Most male infertility is due to the testes failing to make any or enough normal sperm to allow conception. A low sperm count, sperm not moving normally, or a high proportion of abnormally shaped sperm reduce capacity to fertilise eggs.

In most cases, the cause of male infertility is unexplained. A specific cause can only be pinpointed in about 40% of infertile men. They include genetic abnormalities, past infection, trauma to the testicles, and damage to sperm production – for example from cancer treatment. Some men have no sperm in their ejaculate (a condition called azoospermia). This can be due to blocked sperm tubes, which may be a birth defect, or follow vasectomy or other damage.

Doctor showing man results on a page
In most cases the cause of male infertility is unexplained.
Shutterstock

In a minority of cases, infrequent or poorly timed intercourse, or sexual problems such as erectile dysfunction or ejaculation failure cause the infertility.

The least common problem is deficiency of hormonal signals from the pituitary gland (a gland on the brain which makes, stores and releases hormones). This can be genetic or follow issues such as a pituitary tumour. Treatment with hormone injections aims to restore natural fertility.

Chronic diseases such as obesity or diabetes, environmental exposures (such as chemicals in the workplace) and lifestyle factors (such as smoking and recreational drug use) can contribute to or exacerbate poor sperm quality.

Male infertility and chance of IVF success

For couples with male factor infertility, intracytoplasmic sperm injection (ICSI) is needed to fertilise the eggs and give them a chance of having a baby. ICSI follows the same process as IVF, except ICSI involves the direct injection of a single sperm into each egg using technically advanced equipment, as opposed to IVF, where thousands of sperm are added to each egg in the hope one will fertilise it.




Read more:
Standard IVF is fine for most people. So why are so many offered an expensive sperm injection they don’t need?


The just released ANZARD report shows the chance of a baby for men with male infertility is comparable with other infertility diagnoses. However, studies show that for couples who don’t have male factor infertility, ICSI offers no advantage over IVF in terms of the chance of having a baby.

Five tips for sperm health

Although most male infertility is not preventable, there are some things men can do to keep their sperm healthy. It takes about three months for sperm to mature, so making healthy changes at least three months before trying for a baby gives the best chance of conception and having a healthy baby. Here are five things you can do to look after your sperm.

1. Quit smoking

Cigarette smoke contains thousands of harmful chemicals that cause damage to all parts of the body, including sperm. Heavy smokers make fewer sperm than non-smokers. Smoking can increase the number of abnormally shaped sperm and affect the sperm’s swimming ability, making it harder for sperm to reach and fertilise the egg.

Smoking also damages the DNA in sperm, which is transferred to the baby. This can increase the risk of miscarriage and birth defects in a child. One study found heavy smoking (more than 20 cigarettes a day) by fathers at the time of conception increases the child’s risk of childhood leukemia.

Man lighting cigarette
Smoking affects sperm quantity, shape and motility.
ravi sharma/unsplash, CC BY

There is no safe limit for smoking – the only way to protect yourself and your unborn baby from harm is to quit. The good news is the effects of smoking on sperm and fertility are reversible, and quitting will increase the chance of conceiving and having a healthy baby.

2. Try to be a healthy weight

On average, men who are overweight or obese have lower sperm quality than men who are a healthy weight. Carrying too much weight can also reduce your interest in sex and lead to erection problems.

The good news is, even losing a few kilos can improve sperm quality. Getting support, setting realistic goals and giving yourself enough time to achieve them, learning about nutrition and healthy eating, and exercising regularly increase your chance of losing weight and keeping it off.

3. Back off drugs and alcohol

Taking androgenic steroids for bodybuilding or competitive sports causes testes to shrink and affects sperm production. And it can have a lasting impact. It takes about two years for sperm to return to normal after stopping steroids.

A man’s fertility can also be harmed by other drugs like cannabis, cocaine and heroin, as they reduce testosterone levels and sex drive (libido).

Alcohol is OK in small amounts, but heavy drinking and binge drinking can reduce sperm count and quality.

4. Don’t leave it too late

We’ve all heard about men in their 80s and 90s fathering children, but this is rare and risky.

Although men continue to produce sperm throughout life, which means they can potentially reproduce into old age, men under 40 have a better chance of conceiving than older men.

It takes longer for partners of older men to conceive, and sperm quality declines with age and this increases the risk of miscarriage and health problems for the baby.

So, if you have a choice about when to try for a baby, sooner is better than later.




Read more:
Do you really need IVF? A new online tool can help you weigh up your options


5. Be aware of sexually transmitted infections

Sexually transmitted infections (STIs), especially untreated gonorrhoea and chlamydia, can reduce sperm quality and cause blockages in the sperm tubes. This means sperm can’t move on from the testicles (where they are produced) into the semen to then be ejaculated.

Practising safe sex by using condoms is the only thing that can stop STIs from being passed to or from a partner. Using condoms hugely reduces your risk of tube blockages and damage to your fertility. If you think you have an STI, see a doctor and get treatment straight away. The quicker you get treatment, the lower the risk of fertility problems in the future.

The Conversation

Karin Hammarberg works for the Victorian Assisted Reproductive Treatment Authority (VARTA).

Professor Georgina Chambers is an employee of the University of New South Wales, Sydney (UNSW). UNSW receives funding from the Fertility Society of Australia and New Zealand (FSANZ) to produce the Australian and New Zealand Assisted Reproductive Technology (ANZARD) annual reports. UNSW has received a research grant from the MRFF on behalf of Prof Georgina Chambers to undertake research into male infertility.

Professional Robert McLachlan owns shares in the Monash IVF Group

Past NHMRC grants and one current MRFF grants in male reproductive health

ref. Problems conceiving are not just about women. Male infertility is behind 1 in 3 IVF cycles – https://theconversation.com/problems-conceiving-are-not-just-about-women-male-infertility-is-behind-1-in-3-ivf-cycles-192183

Social media use and poor wellbeing feed into each other in a vicious cycle. Here are 3 ways to avoid getting stuck

Source: The Conversation (Au and NZ) – By Hannah Jarman, Research Fellow, Deakin University

Shutterstock/The Conversation

We often hear about the negative impacts of social media on our wellbeing, but we don’t usually think of it the other way round – whereby how we feel may impact how we use social media.

In a recent study, my colleagues and I investigated the relationship between social media use and wellbeing in more than 7,000 adults across four years, using survey responses from the longitudinal New Zealand Attitudes and Values Study.

We found social media use and wellbeing impact each other. Poorer wellbeing – specifically higher psychological distress and lower life satisfaction – predicted higher social media use one year later, and higher social media use predicted poorer wellbeing one year later.

A vicious cycle

Interestingly, wellbeing impacted social media use more than the other way round.

Going from having “no distress” to being distressed “some of the time”, or “some of the time” to “most of the time”, was associated with an extra 27 minutes of daily social media use one year later. These findings were the same for men and women across all age groups.

This suggests people who have poor wellbeing might be turning to social media more, perhaps as a coping mechanism – but this doesn’t seem to be helping. Unfortunately, and paradoxically, turning to social media may worsen the very feelings and symptoms someone is hoping to escape.

Our study found higher social media use results in poorer wellbeing, which in turn increases social media use, exacerbating the existing negative feelings, and so on. This creates a vicious cycle in which people seem to get trapped.

If you think this might describe your relationship with social media, there are some strategies you can use to try to get out of this vicious cycle.

Reflect on how and why you use social media

Social media aren’t inherently bad, but how and why we use them is really important – even more than how much time we spend on social media. For example, using social media to interact with others or for entertainment has been linked to improved wellbeing, whereas engaging in comparisons on social media can be detrimental to wellbeing.

So chat to your friends and watch funny dog videos to your heart’s content, but just watch out for those comparisons.

What we look at online is important too. One experimental study found just ten minutes of exposure to “fitspiration” images (such as slim/toned people posing in exercise clothing or engaging in fitness) led to significantly poorer mood and body image in women than exposure to travel images.

And mindless scrolling can also be harmful. Research suggests this passive use of social media is more damaging to wellbeing than active use (such as talking or interacting with friends).

A person scrolls through a social media site on their phone
Mindless scrolling can be damaging to your wellbeing.
Shutterstock

So be mindful about how and why you use social media, and how it makes you feel! If most of your use falls under the “harmful” category, that’s a sign to change or cut down your use, or even take a break. One 2015 experiment with more than 1,000 participants found taking a break from Facebook for just one week increased life satisfaction.




Read more:
Doomscrolling is literally bad for your health. Here are 4 tips to help you stop


Don’t let social media displace other activities

Life is all about balance, so make sure you’re still doing important activities away from your phone that support your wellbeing. Research suggests time spent outdoors, on hobbies or crafts, and engaging in physical activity can help improve your wellbeing.

So put your phone down and organise a picnic with friends, join a new class, or find an enjoyable way to move your body.

Address your poor wellbeing

According to our findings, it may be useful to think of your own habitual social media use as a symptom of how you’re feeling. If your use suggests you aren’t in a good place, perhaps you need to identify and address what’s getting you down.

The first, very crucial step is getting help. A great place to start is talking to a health professional such as your general practitioner or a therapist. You can also reach out to organisations like Beyond Blue and Headspace for evidence-based support.




Read more:
A month at sea with no technology taught me how to steal my life back from my phone


The Conversation

Hannah Jarman does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.

ref. Social media use and poor wellbeing feed into each other in a vicious cycle. Here are 3 ways to avoid getting stuck – https://theconversation.com/social-media-use-and-poor-wellbeing-feed-into-each-other-in-a-vicious-cycle-here-are-3-ways-to-avoid-getting-stuck-191590

Could the Senate inquiry into missing and murdered Indigenous women and children prevent future deaths?

Source: The Conversation (Au and NZ) – By Kyllie Cripps, Scientia Associate Professor, School of Law, Society & Criminology, Faculty of Law & Justice, UNSW Sydney, UNSW Sydney

GettyImages

Aboriginal and Torres Strait Islander readers are advised this article contains names of deceased people and mentions domestic violence and murder.


Public hearings have officially commenced into the Senate Committee Inquiry into Missing and Murdered Indigenous Women and Children. The inquiry has found “Murder rates for Indigenous women are eight times higher than for their non-Indigenous counterparts”. This came as no surprise to many of us who have worked in this field for a long time.

In fact, these numbers are likely to be higher when they include manslaughter rates. The rate at which women are murdered in Australia over time (2005-06 to 2019-20) have been declining. But according to the Homocide Report Australia 2019 -20, report, this sadly is not the case for Indigenous women.

When women are murdered in Australia, there is understandable outrage, displays of grief and moments of reflection in our parliament.

However, there is often silence in the media and in public discussion about the violence Indigenous women experience, as Indigenous studies Professor Bronwyn Carlson has discussed.

This inquiry has the potential to provide voice to the Indigenous women and children we have lost and continue to lose to violence, as well as ending the silence that follows.




Read more:
No public outrage, no vigils: Australia’s silence at violence against Indigenous women


What is this senate inquiry?

In November 2021, First Nations Greens senators Dorinda Cox and Lidia Thorpe called for a Senate inquiry into the high rates of missing and murdered Indigenous women and children in Australia. Through measures including hearing testimony from survivors of violence and examining police responses, this will be an opportunity to investigate what can be changed to better address violence against Indigenous women and children in Australia.

Available data tell us Indigenous women represent up to 10% of unsolved missing persons cases in Australia, many of whom are presumed dead. Indigenous women are also 30 times more likely to be hospitalised for assault-related injuries. As part of its public hearings, the inquiry is examining these damning statistics.

However, the inquiry is also delving deeper, asking more about the women’s stories, with the intention to go beyond statistics and hear how people are affected by their experiences with family violence.

Police and domestic violence services are not helping

My research has found violence against Indigenous women is significantly under-reported and perpetrators regularly go unpunished. This is not to say Indigenous women are not crying out for support: they are and have been. However, they are often confronted with a dilemma of who is safe to turn to, and what the consequences of reporting might be.

For First Nations women, there are significant risks to consider when reporting violence to police or seeking assistance from domestic violence services. These risks include their children being taken from them by child protection services, the women themselves being arrested for unrelated criminal matters, and the risk of being misidentified as the perpetrator.

Criminology and law researcher Emma Buxton-Namisnyk’s study of domestic violence policing of First Nations women in Australia found “there were very few examples of police interventions that did not produce some identifiable harm”. Buxton-Namisnyk found this harm was through police inaction and non-enforcement of domestic violence laws. Some instances involved police action resulting in “eroding victim’s agency” through criminalising victims and increasing police surveillance over their families.

In June 2022, Acting Coroner Elisabeth Armitage handed down damning findings against the Northern Territory Police in the death of Roberta, an Aboriginal woman from the Katherine region. Armitage said the police “did nothing to help her”. In fact, the fatal assault was the seventh time Roberta’s partner had abused her in less than two weeks. It was five days after Roberta had been told by police to “stop calling us”.

Armitage summed up this case as one in which police failed to follow any of their procedures concerning domestic violence complaints. She also found their manner towards Roberta was rude and dismissive.

These actions and failures were not confined to the actions of police. The triple-zero call operator incorrectly classified Roberta’s calls for help, and the parole officer tasked with supervising Roberta’s partner was oblivious to his breaches of parole conditions. The breakdown in communication across these services and the lack of support available to Roberta created the conditions that led to her death.

This case also speaks to a broader issue of bystanders who fail to act on our women’s cries for help. The Northern Territory is a unique jurisdiction in that it is mandatory for all adults to report domestic violence “when the life or safety of another person is under serious or imminent threat” or be liable for a fine up to $20,000.

Despite this, Armitage explained there were witnesses to the violence Roberta endured, who did not report. To my knowledge, no one has been held accountable for failing to report.




Read more:
Unintended, but not unanticipated: coercive control laws will disadvantage First Nations women


There are stories behind the numbers

During this Senate inquiry, politicians need to consider the stories behind the statistics, such as Roberta’s. It is these stories that demonstrate the need for domestic and family violence death reviews in all of our states and territories. They provide the opportunity to understand the victim’s story and how it is affected by services and systems currently in place.

But it’s also critical Indigenous people are included in the process of reviews and the analysis of what keeps going wrong with services that are meant to save lives.
In addition to this, there needs to be an extensive review of cases over time to understand trends in missing and murdered Indigenous women and children. We need to find out whether systemic problems or issues in practice are responsible for failing these women.

As the United Nations’ violence against Indigenous women and girls report states, Indigenous women already have to navigate violence in the form of racial discrimination and system inequities. Our calls for help need to be met with a culturally safe person who can hear our stories and respond with care and respect to help us navigate our way to safety.

The Conversation

Kyllie Cripps with colleagues from UNSW receives funding from the Australian Research Council – her UNSW profile provides further detail as to the projects this relates too.

ref. Could the Senate inquiry into missing and murdered Indigenous women and children prevent future deaths? – https://theconversation.com/could-the-senate-inquiry-into-missing-and-murdered-indigenous-women-and-children-prevent-future-deaths-192020

Doing away with COVID isolation rules means increased isolation and risks for people with disability

Source: The Conversation (Au and NZ) – By Anne Kavanagh, Professor of Disability and Health, Melbourne School of Population and Global Health, The University of Melbourne

Unsplash, CC BY

Mandatory isolation rules for people with COVID end today. Pandemic leave disaster payments will also cease for all workers except casual workers employed in aged care, disability, hospitals, Indigenous health services and hospitals.

These changes signal the end of most legislated COVID safeguards. Rules to enforce mask-wearing on public transport, vaccination for entry to public spaces, and isolation of close contacts have been dropped by state and territory governments in recent months.

Many places have also discontinued vaccine mandates for workers in sectors such as aged care, disability, and health.

Despite the clear benefits of good indoor ventilation to reduce COVID transmission risk, many schools, workplaces, and public spaces are poorly ventilated.

The withdrawal of active protections plus the failure to ensure safe indoor air puts people with disability at greater risk than the rest of the population. Action is needed to protect this group.




Read more:
If you think scrapping COVID isolation periods will get us back to work and past the pandemic, think again


People with disability face deadly risks

International studies show disabled people are at higher risk of dying from COVID than their age-matched peers. People with intellectual and psychosocial disability (such as schizophrenia, bipolar disorder and social anxiety disorders) are at the highest risk – three to nine times that of the general population.

In England between Jane 2020 and March 2022, 60% of people who died from COVID were disabled.

To date, comparable data has still not been reported for Australians with disability. But there is no reason to believe the risk for disabled Australians is any different than overseas.

Some people with disability are clinically vulnerable because they are immunocompromised due to medications for conditions such as for rheumatoid arthritis or multiple sclerosis. This group also has a higher prevalence of conditions like diabetes, cardiovascular and respiratory disease. These are associated with serious disease and death from COVID.

Many disabled Australians also have difficulties accessing health care because of physical inaccessibility and lack of knowledge and expertise of health care providers about disability. This means they may not receive anti-viral COVID treatments, even if they are eligible.




Read more:
Imagining COVID is ‘like the flu’ is cutting thousands of lives short. It’s time to wake up


Enforced isolation

Many people with disability continue to isolate at home to avoid infection and are effectively shut out of society as online options for participation dry up.

For people who rely on paid support, isolation is not an option. Their workers are still circulating in the community. Some disabled people live and work in congregate environments with other people with disability – settings associated with higher rates of COVID infection and death.

A significant minority of people with disability have not had the recommended COVID vaccinations and boosters.

Almost one quarter of participants in the National Disability Insurance Scheme (NDIS) aged 16 and over have not had three COVID vaccine doses; less than one-third have had four doses. A third of NDIS participants aged 12 to 15 have not had two COVID vaccine doses. The vaccination rates of the 88% people with disability who are not on the NDIS are not reported.

A forgotten workforce

Disability support workers we spoke to in 2020 told us they felt forgotten by government without access to personal protective equipment and tailored information about how to protect themselves and people they supported.

Workers we surveyed in 2021 reported higher levels of vaccine hesitancy than the general population and expressed concerns about vaccine safety and efficacy.

Concern about what’s next

Without isolation periods in place, people with disability are deeply concerned about what will happen when new immune-evasive variants of SARS-CoV-2 (the virus that causes COVID) arrive.

Throughout the pandemic, disability advocates and supporters and academics have drawn attention to the risks of COVID for disabled people.

The Royal Commission into Violence, Abuse, Neglect and Exploitation of People with Disability criticised the federal government for its slow initial efforts to protect people with disability during the pandemic and for delays in the vaccination rollout.

Governments around the world have reassured the public COVID is more dangerous for the chronically ill, elderly and disabled. This has the effect of suggesting their/our lives matter less.

Public health measures – or decisions to end them – signal what our society is prepared to do to care for people at risk. Some advocates have labelled the relaxation of COVID protections as ableist, even eugenicist. Others say it will guarantee the societal exclusion of the clinically vulnerable.

With evidence long COVID can affect one in 20 of those infected, including previously healthy people, the proportion of disabled people in our community will likely swell in coming years.




Read more:
Long COVID should make us rethink disability – and the way we offer support to those with ‘invisible conditions’


5 COVID protections needed for people with disability

Strategies to minimise the COVID risk for people with disability should include:

  • concerted government campaigns to increase uptake of third and fourth doses among people with disability

  • continued access to free rapid antigen tests (RATs) for people with disability and support workers

  • advice about ventilation of indoor spaces, particularly in congregate settings with access to air quality monitors and purifiers if needed

  • free access to respirator (P2/N95) masks for use indoors

  • outreach to ensure people with disability who are eligible for antiviral treatment can access it promptly.

Governments need to work with services and workers to make sure they understand the risks to people with disability if they have symptoms of COVID or other respiratory infections.

Workers who test positive for COVID should be blocked from face-to-face support of people with disability for at least seven days and pending a negative RAT. Access to paid isolation leave for disability workers is critical, so they don’t have to choose between exposing the people with disability they support to illness and paying the rent.

Finally, when new COVID variants and waves inevitably emerge, governments will need to remain open to reintroducing measures including isolation of positive cases and mask-wearing indoors. This could avoid devastating outcomes for people with disability and other Australians at increased risk of serious disease and death.

The Conversation

Anne Kavanagh receives funding from National Health and Medical Research Council and Australian Research Council. She has received funding from Victorian and Commonwealth governments and the National Disability Agency. She is a member of the COVID-19 Disability Advisory Committee and Commonwealth Disability Health Sector Consultative Commitee.

Helen Dickinson receives funding from ARC, NMHRC, Commonwealth government and CYDA.

The School Nancy Baxter leads receives research grant funding from the National Health & Medical Research Council of Australia, Australian Research Council, and other Australian federal and Victorian State Government bodies. She serves on the Advisory Board of The Australian Global Health Alliance and on the Board of the Nossal Institute. She has been an unpaid participant in an Advisory Board meeting for MSD Australia.

ref. Doing away with COVID isolation rules means increased isolation and risks for people with disability – https://theconversation.com/doing-away-with-covid-isolation-rules-means-increased-isolation-and-risks-for-people-with-disability-191943

Global warming puts Arabica coffee at risk, and we’re barrelling towards a crucial threshold

Source: The Conversation (Au and NZ) – By Jarrod Kath, Senior Lecturer in Ecology and Conservation, University of Southern Queensland

Jason Betz/Unsplash, CC BY

Coffee may be a major casualty of a hotter planet. Even if currently declared commitments to reduce emissions are met, our new research suggests coffee production will still rapidly decline in countries accounting for 75% of the world’s Arabica coffee supply.

Arabica coffee (Coffea arabica) is one of two main plant species we harvest coffee beans from. The plant evolved in the high-altitude tropics of Ethiopia, and is hypersensitive to changes in the climate.

Our research shows there are global warming thresholds beyond which Arabica coffee production plummets. This isn’t just bad news for coffee lovers – coffee is a multi-billion dollar industry supporting millions of farmers, most in developing countries.

If we manage to keep global warming below 2℃ this century, then producers responsible for most global Arabica supply will have more time to adapt. If we don’t, we could see crashes in Arabica productivity, interruptions to supply, and price hikes on our daily cup.

Where our coffee comes from

Most of our Arabica is grown in the tropics, throughout Latin America, Central and East Africa and parts of Asia. Brazil, Colombia and Ethiopia are the world’s top three producers of Arabica, and the crop has crucial social and economic importance elsewhere, too.

Millions of farmers, mostly in the developing world, depend on productive Arabica for their livelihood. If coffee productivity declines, the economic consequences for farmers, some of which do not earn a living income as it is, are dire.




Read more:
A tale of two coffee farmers: how they are surviving the pandemic in Honduras


Arabica coffee is typically most productive in cool high elevation tropical areas with a local annual temperature of 18-23℃.
Higher temperatures and drier conditions invariably lead to declines in yield.

Last year, for example, one of the worst droughts in Brazil’s history saw coffee production there drop by around one-third, with global coffee prices spiking as a result.

What we found

Previous research has focused on how changes in temperature and rainfall affect coffee yields. While important, temperature and rainfall aren’t the best indicators of global Arabica coffee productivity. Instead, we found that it’s more effective to measure how dry and hot the air is, which we can do using “Vapour Pressure Deficit”.

Vapour pressure deficit tells us how much water gets sucked out of a plant. Think of when you walk outside on a hot, dry day and your lips dry and crack – the moisture is being sucked out of you because outside, the vapour pressure deficit is high. It’s the same for plants.

We built scientific models based on climate data that was linked to decades of coffee productivity data across the most important Arabica producing countries. We found once vapour pressure deficit gets to a critical point, then Arabica coffee yields fall sharply.

Coffee crops have crucial social and economic importance.
Yanapi Senaud/Unsplash, CC BY

This critical point, we found, is 0.82 kilopascals (a unit of pressure, calculated from temperature and humidity). After this point, Arabica yields start falling fast – a loss of around 400 kilograms per hectare, which is 50% lower than the long-term global average.

Vapour pressure deficit thresholds have already been exceeded in Kenya, Mexico and Tanzania.

Unabated global warming will see the world’s coffee producing powerhouses at risk. If global warming temperatures increase from 2℃ to 3℃, then
Peru, Honduras, Venezuela, Ethiopia, Nicaragua, Colombia and Brazil –
together accounting for 81% of global supply – are much more likely to pass the vapour pressure deficit threshold.

What can we do about it?

While there are ways farmers and the coffee industry can adapt, the viability of applying these on a global scale is highly uncertain.

For example, irrigating coffee crops could be an option, but this costs money – money many coffee farmers in developing countries don’t have. What’s more, it may not always be effective as high vapour pressure deficits can still inflict damage, even in well-watered conditions.

Another option could be switching to other coffee species. But again, this is fraught. For example, robusta coffee (Coffea canephora) – the other main species of production coffee – is also sensitive to temperature rises. Others, such as Coffea stenophylla and Coffea liberica could be tested, but their production viability at large scales under climate change is unknown.




Read more:
Plunger, espresso, filter? Just because your coffee is bitter, doesn’t mean it’s ‘stronger’


There is only so much adapting we can do. Our research provides further impetus, if we needed any, to cut net global greenhouse gas emissions.

Limiting global warming in accordance with the Paris Agreement is our best option to ensure we can all keep enjoying coffee. More importantly, keeping global warming below 2℃ is the best way to ensure the millions of vulnerable farmers who grow coffee globally have a livelihood that supports them and their families well into the future.

The Conversation

Jarrod Kath receives funding from the Federal Ministry for the Environment, Nature Conservation and Nuclear Safety—International Climate Initiative (IKI).

Scott Power receives funding from DFAT as a climate science advisor to the Australia Pacific Climate Partnership, from DAFF as a technical adviser on DR.SAT and Climate Services for Agriculture, and from the Australian Water Partnership, and he manages Climate Services International.

ref. Global warming puts Arabica coffee at risk, and we’re barrelling towards a crucial threshold – https://theconversation.com/global-warming-puts-arabica-coffee-at-risk-and-were-barrelling-towards-a-crucial-threshold-189559

What is DLD – the most common disorder you have ‘never heard of’?

Source: The Conversation (Au and NZ) – By Linda J. Graham, Professor and Director of the Centre for Inclusive Education, Queensland University of Technology

Josh Applegate/Unsplash

Developmental language disorder or DLD is a lifelong disorder that affects language comprehension and expression. People with DLD find it more difficult to say what they mean and to understand others.

About two students in every classroom of 30 will have DLD, so it is about as common as attention-deficit hyperactivity disorder (ADHD) and much more common than autism.

In fact, DLD has been described as the most common disorder that most people “have never heard of”.

We are researchers in inclusive education, who specialise in how schools can best support students who experience language difficulties. We work with a lot of these students and know how easily these difficulties are either missed or misinterpreted.

How does this happen?

In a new study, our team at QUT’s Centre for Inclusive Education surveyed more than 260 Australian teachers in both primary and secondary schools.

We asked them to rate how good they were at identifying students with DLD, from 1 = “poor” to 5 =“excellent”. The average response was 2.77 (or just below “reasonable”).




Read more:
If your child has reading, school or social struggles, it may be DLD: Developmental language disorder


Participants were then provided with a list of ten characteristics and asked to identify those reflecting difficulties with speech (how we say sounds and words), those reflecting difficulties with language (how we share ideas), and those reflecting difficulties with both. It is important teachers can distinguish between the two to provide the right support.

Their overall accuracy was 48%, suggesting teachers need to know more about DLD than they think they do. Worryingly, discrepancies between teachers’ perceived and actual knowledge could work to prevent them from seeking the professional learning they need.

Under the radar

DLD flies under the radar because its characteristics are subtle and easily misinterpreted. But the implications are serious if teachers don’t know about DLD or how to support these students.

Students with DLD struggle academically and socially because language is how friendships are made and the school curriculum is taught. Students with DLD often perform well below their classmates.

Children on a swing.
Children with DLD can find it hard to make and maintain friendships.
Kelly Sikkema/Unsplash

Without support, students with DLD can begin to feel ashamed, frustrated, and misunderstood, which can lead to behavioural problems, suspension, leaving school early and unemployment.

What should parents and teachers look for?

DLD has been described as “hiding in plain sight” because it is mistaken for other things, such as poor behaviour or lack of interest in school.

But there are some indicators which should prompt further investigation by a qualified speech pathologist. These include:

  • difficulties learning to read, followed by avoidance of reading

  • difficulties with writing, often characterised by mistakes when it comes to sequencing in a story (explaining what happened and when)

  • difficulty following instructions or directions. Problems in this area are particularly noticeable when the child is provided with multiple instructions but misses key steps or becomes muddled without seeking help from peers

  • appearing chatty, but having a relatively limited vocabulary for their age. A child may use a lot of “filler” words like, “things” or “stuff” in place of words that they either don’t know or can’t recall

  • using substitutes that sound similar but do not have the same meaning. For example, “sufficient” instead of “efficient”, or “pacific” rather than “specific”

  • using made up words or incorrect word combinations, such as “tooken” or “racehorsing”, beyond the early years of school when errors like this are not uncommon.

These indicators are often not noticed by teachers and parents/carers who act as interpreters and guess what the child really means without even being aware that they are doing it.

Although well-intentioned, this can mean that the child’s difficulties with language remain undetected.

What helps students with DLD?

Because DLD is not as well-known as ADHD or autism, some misperceptions exist. One is it can be “cured” through speech-language therapy. As many as four in five (81.7%) Australian teachers in the QUT study believed this to be the case.

While speech pathology support is important, particularly in the early years, it will not address ongoing comprehension challenges faced by children with DLD, especially in the classroom.

Here, teachers can make a difference. In another study published this year, we asked 50 students in years 7 to 10 with language and behavioural difficulties, “what makes an excellent teacher?”. They said excellent teachers made themselves easy to understand by:

  • reducing the number of instructions and the “wordiness” of explanations, as well as the speed and complexity of what they say

  • building in pauses to allow students’ time to process instructions

  • providing written instructions as well as simple visual supports

  • emphasising and reiterating key points

  • introducing and explaining new or tricky words

  • making sure they have students’ full attention before teaching

  • regularly maintaining that attention through cues, gestures and routines.

These simple practices are critical for students with DLD, but they also benefit all students. This is because we all learn and process language in the same way. If teachers are very clear with students, it reduces the likelihood a student will get overwhelmed or misunderstand a lesson.

Where to go next

Parents who are worried about language development should talk to their child’s teacher, who can follow up with the school’s learning support team.




Read more:
From shopping lists to jokes on the fridge – 6 ways parents can help their primary kids learn to write well


Parents and teachers can also access more information about DLD from the Raising Awareness of DLD website, listen to this federal government-supported podcast or this QUT presentation on supporting students with DLD in the classroom.

Most importantly, they need to know and remember that with the right support, students with DLD can succeed socially and academically.

Jaedene Glasby was the lead author of the first study described in this article.

The Conversation

Linda J. Graham receives funding from the Australian Research Council (ARC) and the Queensland Government.

Haley Tancredi receives funding from the Australian Research Council (ARC) and the Queensland Government.

ref. What is DLD – the most common disorder you have ‘never heard of’? – https://theconversation.com/what-is-dld-the-most-common-disorder-you-have-never-heard-of-189979

Australian women are more educated than men, but gender divides remain at work

Source: The Conversation (Au and NZ) – By Michael Coelli, Associate professor, The University of Melbourne

Shutterstock

The Bureau of Statistics has just released a new set of data from the 2021 census. The first set – released in June 2022 – covered topics including age, sex, religion, unpaid work and country of birth.

The second set, released on Wednesday, provides insights into the kinds of jobs Australians have (and if they have a job), how Australians travel to work (and if they still do), and their educational qualifications.

There is plenty to digest. I’ll focus on a couple of interesting outcomes:

  • differences in the types of jobs held by men and women,

  • differences in the educational qualifications of men and women.

The most male and female jobs

Men accounted for around 99% of Australia’s bricklayers and stonemasons, plumbers, sheetmetal trades workers, carpenters and joiners, roof tilers and concreters in 2021.

Women accounted for 97% or more of Australia’s midwives, early childhood teachers, dental assistants, personal assistants and beauty therapists.



But the segregation is becoming weaker over time.

One common measure is the Duncan index of dissimilarity. It records the proportion of female workers who would have to change their occupations in order for female representation to be even across all occupations.

I have calculated this measure using census data from 1966 up to 2021, updating work I completed with Jeff Borland up to 2011.




Read more:
The 2021 Australian census in 8 charts


The encouraging news is that segregation is declining, and declined further in the past two censuses. Having said that, the occupational differences are still large.

Back in 1966, nearly two-thirds of women would have had to change occupations in order to be spread across occupations as men are. By 2021, the proportion had fallen to close to half.



As women joined the workforce in greater numbers from 1966 to 2021, the proportion of women in most broad occupational groups grew.

But the growth has differed by the type of job. The proportion of women in managerial occupations grew from around 18% in 1966 to nearly 40% in 2021.

The proportion in professional occupations grew from 35 to 56%. In technical and trades occupations, it only grew from 8 to 17%.




Read more:
Yet again, the census shows women are doing more housework. Now is the time to invest in interventions


Some recent increases (from 2006 to 2021) in the proportion of women in specific manager and professional occupations stand out. These include vets (from 46% to 66%), dentists (31% to 47%), barristers (22% to 38%), school principals (50% to 65%) and internal medical specialists (32% to 47%).

But some professional occupations have gone the other way. The proportion of women working as financial dealers fell from 41% to 31%. The proportion of women working as physiotherapists fell from 71% to 64%.

Highly educated young women

The increasing shares of women in professional occupations is matched by increasing education attainment.

The proportion of females aged in their 30s with a bachelor’s degree or higher qualification was one half in 2021. This is strikingly higher than both the proportion of males in that age group with a bachelor’s degree or higher (about 38%) and the proportion of older females with degrees, which was 11% for females over 75.



This difference indicates how rapidly female university education has grown.

Female university graduates now outnumber male university graduates in every age group below 70.

But the proportion of males with certificates and diplomas is higher than the proportion of females across all age groups from 20 up.

This is reflected in the still-low proportion of females in technical and trades occupations.



More to explore

Gender differences in jobs and education are just two of the many ways the census can help us understand Australia.

Every five years it presents researchers and the curious with a lot to explore, including changes over time.

A few years back the five-yearly census was facing the axe. It would be great if it continued to provide these insights for decades to come.




Read more:
The gender qualification gap: women ‘over-invest’ in workplace capabilities


The Conversation

Michael Coelli receives funding from the Australian Research Council. He has also completed some analysis work for AI Group.

ref. Australian women are more educated than men, but gender divides remain at work – https://theconversation.com/australian-women-are-more-educated-than-men-but-gender-divides-remain-at-work-191944

The Right Stuff: the new conservative dating app which has unsurprisingly, failed to attract women

Source: The Conversation (Au and NZ) – By Lisa Portolan, PhD student, Institute for Culture and Society, Western Sydney University

Austin Distel/Unsplash

The Right Stuff is a new conservative dating app, recently launched in the US. Not yet available in Australia, the app was apparently created “for conservatives to connect in authentic and meaningful ways.”

It offers to bring people together with shared values and similar passions, ensuring users “view profiles without pronouns” and are able to “connect with people who aren’t offended by everything”.

As you might anticipate, the app has drawn immediate, and controversial attention, for a variety of reasons. Firstly, and importantly, there appears to be an absence of female-users. Problematic, given the app only caters for an heterosexual audience.

Secondly, the app was co-founded by former Trump aide John McEntee. Ryann McEnany, the sister of the former White House press secretary Kayleigh McEnany, is the app’s spokesperson. Finally, the app is financially backed by right-wing billionaire and PayPal co-founder Peter Thiel.

The ads for the app have also attracted a level of derision from audiences. Featuring an all-female cast, women are asked “What they’re looking for in a man?”

They respond they are looking for an “alpha male vibe”, an independent man, a man who is family-orientated.

When women in the video were asked what their “biggest red flag” in their potential partners was. They all replied they couldn’t be with a Democrat.




Read more:
The exclusive dating app for celebrities and influencers – why Raya has been called ‘the Illuminati of the Tinder world’


Politics and dating apps

This isn’t the first dating app to intersect tech, dating, intimacy and politics.

In 2016, Bumble launched its political digital “bumper stickers”, which featured Hillary Clinton, Bernie Sanders, Ted Cruz and, of course, Trump. These were later updated, replaced by iterations reflecting the political times.

In America, the app currently allows you to share whether or not you have voted in the mid-term elections. Whitey Wolfe Herd, creator and CEO of Bumble, has said:

Political views are more than just current topics, sometimes entire value sets can be tied to political views. It tells you a lot about a person.

In 2020, OkCupid launched its “Voters Make Better Lovers” campaign in advance of the presidential election.

In a press release, the company said “practising your right to vote is the biggest turn-on to OkCupid singles today”.




Read more:
‘High maintenance’ is a red flag on dating apps. Women are still expected to shrink themselves


Shared values

Speaking to the Slow Love podcast in 2020, OkCupid’s then chief marketing officer, Melissa Hobley, said users on the app were increasingly making match-decisions based on shared values, with political inclinations and climate philosophies ranking highly in the mix.

In my research into dating apps and intimacy, I have found women would quickly ghost matches who made racist, sexist or overly sexualised statements in chat or on their profile.

A man on a phone
Women quickly ghost matches who made racist, sexist or overly sexualised statements.
Dane Deaner/Unsplash

User reviews and media reports have overwhelmingly indicated a lack of women on The Right Stuff. (This has not yet been corroborated by the Right Stuff spokespeople.)

Take this user complaint for example:

These days, it’s hard to find a woman who values my patriotism. My faith. And so after being ghosted by every match on Tinder, I decided to give this app a try. […] But the weird thing was, I couldn’t find any women on it. I don’t know, maybe the app is bugged?

Dating apps are not merely a platform for personal relationships. As Lik Sam Chan, assistant professor at the Chinese University of Hong Kong, explores in his research, apps are an emerging arena for gender and politics. These spaces can provide opportunities for women’s empowerment and men’s performances of masculinity.

Similarly, Australian academic Martin Nakata argues online spaces – such as dating apps – can be understood as digitally mediated “sites of struggle over the meaning of [our] experience”.

Dating apps constitute relatively new sites of culturally and politically mediated encounter. They are emerging as the new digital interface for gender and political negotiation.

Certainly, the launch of the Right Stuff tends to suggest the importance of political orientation for women looking to date – and reveals that right wing values are indeed viewed as “the wrong stuff” for many American women.




Read more:
Looking for love on a dating app? You might be falling for a ghost


The Conversation

Lisa Portolan does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.

ref. The Right Stuff: the new conservative dating app which has unsurprisingly, failed to attract women – https://theconversation.com/the-right-stuff-the-new-conservative-dating-app-which-has-unsurprisingly-failed-to-attract-women-192012

Defend NZ’s ‘fragile democracy’ by tackling disinformation, says advocate

By David Robie

A human rights advocate appealed tonight for people in Aotearoa New Zealand to take personal responsibility in the fight against disinformation and to upskill their critical thinking skills.

Anjum Rahman, project lead of the Inclusive Aotearoa Collective Tāhono, said this meant taking responsibility for verifying the accuracy and source of information before passing it on and not fuelling hate and misunderstanding.

“Our democracy is very fragile,” she warned while delivering the annual David Wakim Memorial Lecture 2022 with the theme “Protecting Democracy in an Online World” at Parnell’s Jubilee Building.

She said communities were facing challenging and rapidly changing times with climate change, conflicts, inflation and the ongoing pandemic.

“If our democracy fails, all those other things fail as well,” she said.

“And for those of us who are more vulnerable it is a matter of life and death.

“Who most stand to lose their freedom if democracy fails? Who will be on the frontline to be exterminated?”

Rahman is co-chair of the Christchurch Call Advisory Network and a member of the Independent Advisory Committee of the Global Internet Forum for Countering Terrorism.

Argued strongly for diversity
As an advocate, she has argued strongly for many years in support of diversity and inclusion and in 2019 was made a member of the New Zealand Order of Merit.

On the third anniversary of the 15 March 2019 mosque massacre, she wrote in a column for The SpinOff that “we don’t need any more empty platitudes of sorrow . . . we need firm action and strong resolve. Across the board.”


The David Wakim Memorial Lecture 2022.                      Video: Billy Hania

The recommendations of the Royal Commission of Inquiry were more critical now than ever, and absolutely urgent, she wrote.

“In a world that feels chaotic, with war, rising prices, anger and hate expressed in protests across the world, our hearts seek a certainty that isn’t there.

“We need more urgency, and in many areas. I’m still disappointed with the Counter-Terrorism legislation passed last year, granting greater powers without evidence of any benefit. Hate speech legislation has been delayed, and we await a full review and overhaul of the national security system.”

A founding member of the Islamic Women’s Council of New Zealand, Rahman gave a wide-ranging address tonight on the online challenges for democracy, and answered a host of questions from the audience of about 100.

“I’m really worried about trolls,” said one. “They affect government, they influence voters, they have an impact on all sorts of decision making – what can be done about it?”

Rahman replied that it was very difficult question – “I wish there was a simple answer.”

The audience at tonight's Pax Christi-hosted David Wakim Memorial Lecture 2022
The audience at tonight’s Pax Christi-hosted David Wakim Memorial Lecture 2022 at Parnell’s Jubilee Building. Image: David Robie/APR

Removing troll incentives
She said there needed to be more education and greater awareness of the activities of trolls and the sort of social media platforms they operated on.

One problem was that the more attention paid trolls got, it often meant the more money they were getting.

A challenge was to remove the incentive being given to them.

Award-winning cartoonist Malcolm Evans asked Rahman what her response was to the global situation “right now” with the invasion of Ukraine where people were “under intense pressure to vilify the Russians . . . treating them as ‘evil’.”

He added that “we live in a time that is probably the most dangerous that I have experienced in my lifetime … we are facing an Armageddon and I blame the media for that.

“It’s a disgrace.”

This led to a discussion by Pax Christi Aotearoa’s Janfrie Wakim about how Evans lost his job as a cartoonist on The New Zealand Herald in 2003 for “naming Israeli apartheid” over the repression of Palestinians to the loud applause of the audience.

‘Quality journalism’ paywalls
In a discussion about media, Rahman said she was disturbed by the failures of the media business model that meant increasingly “quality journalism” was being placed behind paywalls while the public that could not afford paywalls were being served “poor quality” information.

Introducing Anjum Rahman, Pax Christi’s Susan Healy said how “especially delighted the Wakim whanau were” that she had agreed to give the lecture.

David Wakim was the inaugural president of Pax Christi Aotearoa, an independent section of Pax Christi International, a Catholic organisation founded in France at the end of World War Two committed to working “to transform a world shaken by violence, terrorism, deepening inequalities, and global insecurity”.

Growing up in a Sydney Catholic family, Wakim was an advocate of interfaith dialogue. His travels in Muslim countries strengthened his links with the three faiths of Abraham – Judaism, Christianity and Islam.

He helped establish the Council of Christians and Muslims in Auckland, but was especially committed to Palestinian rights.

Wakim died in 2005 and the annual lecture honours his and Pax Christi’s mahi for Tiriti o Waitangi, interfaith dialogue, peace education, human rights and restorative justice.

Anjum Rahman addressing the Pax Christi-hosted David Wakim Memorial Lecture 2022
Anjum Rahman addressing the Pax Christi-hosted David Wakim Memorial Lecture 2022 tonight. Image: Billy Hania video screenshot/APR
Print Friendly, PDF & Email

Article by AsiaPacificReport.nz

Grattan on Friday: Government must find a way to force gas prices down – but how?

Source: The Conversation (Au and NZ) – By Michelle Grattan, Professorial Fellow, University of Canberra

Senior ministers this week have dramatically raised the stakes in the Albanese government’s face-off with gas producers, amid escalating energy prices and dire warnings of worse to come. The question now is how does the government follow through with effective action to match the rhetoric?

Bringing gas prices down in the eastern part of the country is vital in reducing the cost pressures many businesses and households are confronting. Coal and gas prices are the main drivers of soaring electricity bills.

Dealing with gas prices is also important for reinvigorating Australian manufacturing, one of Anthony Albanese’s promises at the election.

And, despite the opposition to gas from some environmental critics, it has a necessary role in the transition to a clean energy future and thus to the government being able to deliver on its ambitious climate policy.

Shaping up as an outspoken protagonist in the current “gas wars”, Industry Minister Ed Husic this week launched a barrage of criticism at the producers.

Husic accused the companies of acting in a way that “would make a locust swarm proud”, bent on an “absolutely rabid pursuit of profit above all else”.

They are “sucking up an Australian resource and selling it at phenomenal prices overseas and doing so in such a way that is putting pressure on manufacturers and households in this country,” he told Sky.

Husic is one of four federal ministers in the front line of trying to bring down local prices.

Treasurer Jim Chalmers highlighted the issue when he told a Tuesday news conference power prices were expected to play “a bigger and bigger part” in Australia’s inflation problem in coming months.

Chalmers said he, Husic, Resources Minister Madeleine King and Energy Minister Chris Bowen were working on what could be done to get gas prices down, declaring action would be taken.

But to what extent all four are on the same page is a moot point.

Traditionally, resources ministers are more sympathetic to producers and industry ministers speak up for the users.

Thus Martin Ferguson, when resources minister in the Rudd government, opposed a Queensland plan for a gas “reservation” scheme. (Ferguson, who went into the industry after retiring from parliament, later changed his mind.)

Such a scheme already operated in Western Australia. The WA policy requires LNG producers to reserve a certain proportion (15%) of their production for domestic use. The state is not part of the eastern states’ national energy market and has some of the lowest gas prices in the OECD.

One wrinkle in the present ministerial mix is that King is from WA. She is charged with trying to deal with a problem that her home state, thanks to its policy setting, doesn’t have.

King recently negotiated a new so-called “heads of agreement” with the gas producers. It was a light-touch deal.

The companies undertook to provide enough gas in the domestic market to avoid any supply problem.

But the rub is that the price at which they supply it won’t be lower than the international price. And that foreign price is very high and rising, driven by the energy crisis in Europe. The international parity price has risen from about $10 a gigajoule a year ago to about $60 for 2023.

The national secretary of the Australian Workers’ Union, Daniel Walton, this week was scathing about King’s “dud” agreement.

The government had a choice, Walton said. “Defend the insane super profits gas exporters are making from the Ukraine war or defend the future of Australian manufacturing and the hundreds of thousands of jobs it supports.”

The government has declined to pull the “trigger” that the Turnbull administration set up to give some potential control over gas supplies in the event of export demands leaving the local market short. The trigger has never been used.

This trigger allows a government to order the companies to set aside a certain amount of gas for domestic use. But it does not go to price, which is at the heart of the present problem.

The government’s challenge is how to separate the domestic market from the international price. But the options available to it are limited, and some involve hurdles too high to surmount.

It has a review of the trigger under way. The mechanism could be made more flexible and fit-for-purpose by removing the long lead time required to activate it and by extending it to include price.

Another course is to strengthen the “code of conduct” that regulates standards in the marketing of gas to industrial customers. Husic said the government would examine having price factored into that code.

The government has ultimate power in that it controls export licences, but to even contemplate using that threat against recalcitrants would send the worst of messages to investors.

A bold option that many experts and others advocate is introducing a super profits tax on the companies. An alternative would be to change the existing petroleum resource rent tax.

But they run into the same brick wall that suggestions of recalibrating the stage 3 tax cuts did – an election undertaking. The then opposition’s pre-election economic plan said “Labor is not proposing tax reforms beyond multinationals”. In recent days, Chalmers has firmly ruled out a super profits tax.

An amended code of conduct and an amended trigger would seem the easiest options. Whatever is done needs to be quick and effective, but there are difficulties and no guarantees. The issue also poses a test for maintaining discipline within the government, giving the contending ministerial views.

Husic said: “We cannot be more clear: if these gas companies think that this is the end of the story and the heads of agreement is all done and dusted, they’ve got another [think] coming”.

Strong words. It would be interesting to know what the companies will be saying to King and what King and Husic will be saying to each other as the government grapples with its next step.

The Conversation

Michelle Grattan has shares in the resources sector.

ref. Grattan on Friday: Government must find a way to force gas prices down – but how? – https://theconversation.com/grattan-on-friday-government-must-find-a-way-to-force-gas-prices-down-but-how-192398

COVID or COVID vaccination can cause dermal fillers to swell up

Source: The Conversation (Au and NZ) – By Michael Freeman, Dermatologist, Associate Professor, Bond University

Pexels/Youssef Labib, CC BY-SA

The growing list of COVID complications is long and surprising – from brain changes and heart disease to skin rashes and COVID toes.

Those who get dermal fillers injected into their face have the possibility of an additional complication: swelling and discomfort if they get COVID or a dose of a COVID vaccine. So should they take extra precautions, or time their treatments?

What are dermal fillers?

Fillers are now one of the most common non-surgical cosmetic procedures. Adding fillers to the face can address facial drooping; injections into the high cheekbone area lift the face.

Today’s patients might receive soft fillers in the lips and mouth areas, combined with botulinum toxins (botox) in overactive facial muscles, and lasers and light sources on the skin.

Dermal fillers are used to address facial asymmetry, which can cause functional, psychological/social, and reduced quality-of-life issues. Cosmetically, dermal fillers may give an immediate confidence boost.

Soft tissue fillers are usually hyaluronic acid products. Some other formulations that stimulate tissues are also used.

Fillers can only be prescribed by a registered medical practitioner.

Although soft tissue fillers are considered safe, several studies have shown complications occur with all filler types. Delayed inflammatory reactions – such as red and/or firm lumps possibly with swelling – are among the most common. The cause of these reactions is unknown, so treatments will vary.




Read more:
8 ways the coronavirus can affect your skin, from COVID toes, to rashes and hair loss


Puffy reactions

From 2020 to August 2021 there were around 19 reports in the medical literature of late inflammatory reactions post COVID or post vaccine occurring between weeks and years after filler treatment. This equates to an incidence range of 0.01% to 4.25% of soft tissue filler procedures. Not all cases are reported.

The reason for such reactions is not fully understood. There are many theories on how they can occur including immune reactions to filler triggered by infection, trauma or vaccination.

So, it is not surprising that in the current COVID pandemic, late inflammatory reactions have been reported after infection with SARS-CoV-2 (the virus that causes COVID) and vaccination to protect against it.

The first results of the US Food and Drug Administration (FDA) on the Moderna vaccine showed adverse events in three patients with soft tissue fillers. Such complications can occur between 15 days and six months after filler injections. And they can occur three to four weeks after COVID infection. Filler complications can begin quickly after receiving a mRNA COVID vaccination, between 13 hours and three weeks post-injection.

Clinical symptoms are redness, swelling, formation of lumps and discomfort in the filled areas. Some of the patients with reported complications have had a history of spontaneous facial swelling after a filler injection, previous vaccinations, or after other medical treatments.

It is not the first time adverse events after filler treatment have been reported after a viral infection, for example after an influenza-like illnesses.

The condition generally has a good response to oral corticosteroids, while some patients need hyaluronidase injections to dissolve the filler.

It has been suggested treatment with an angiotensin-converting enzyme inhibitor (ACE-1, usually prescribed to manage blood pressure), which plays a crucial role in SARS-CoV-2 binding properties, can reduce swelling in late inflammatory reactions.

Genetic factors are likely to play a role in who gets complications after dermal filler injections generally, with studies pinpointing the genes responsible in those who experience reactions. These individuals might have a lower threshold to infections, vaccines, or other factors that trigger an immune response.

What patients can do

Although small in number, the cases so far show adverse reactions with soft tissue filler occur after COVID infection and vaccination. The relationship between these factors seems likely, as they occur within a few hours or up to several weeks afterwards.

To prevent possible complications, the following recommendations have been suggested for those wishing to proceed with a filler:

  • ideally, allow a two- to four-week window between filler injections and vaccination in general, and two months longer for immunocompromised patients (those taking immunosuppressive medications, having chemotherapy, or with immune disorders) or after COVID infection

  • proceed with caution if there is a history of allergies, filler-related adverse events or problems after other types of implants

  • because vaccination protects against severe COVID, long COVID and death, delay the filler rather than the vaccination

  • if a reaction does occur, then your doctor can consider starting treatment with oral steroids, provided there is no infection.




Read more:
Friday essay: toxic beauty, then and now


The Conversation

Michael Freeman is the founder of The Skin Centre, a private dermatology practice which also offers dermal fillers.

ref. COVID or COVID vaccination can cause dermal fillers to swell up – https://theconversation.com/covid-or-covid-vaccination-can-cause-dermal-fillers-to-swell-up-192159

Floods in Victoria are uncommon. Here’s why they’re happening now – and how they compare to the past

Source: The Conversation (Au and NZ) – By Margaret Cook, Lecturer in History, University of the Sunshine Coast

Think Victoria and disasters and you’ll think bushfires. But floods can hit – just not as often.

Today is one of those days, with much of the state under a flood watch. Premier Dan Andrews says the floods are likely to be the most significant in years. Evacuations are likely.

Floodwaters are pushing down the Goulburn to the Murray. Major flooding in the Maribyrnong, which runs through towns and Melbourne’s west. Emergency services say evacuations may be necessary. Towns are sandbagging flood-prone areas. Some have been cut off by rising waters.

The state’s largest dam, Dartmouth, is spilling over. So is Lake Eildon’s dam. And the Thomson dam may well spill this weekend, for the first time in decades. This isn’t the last of it – Victoria’s emergency management commissioner Andrew Crisp has warned intense rains and floods could last up six to eight weeks.

Even as the rest of the eastern seaboard has faced the brunt of three consecutive La Niña years, Victoria has had little flooding until now. Tasmania, too, is facing rare flooding, while flood-weary New South Wales is bracing for more.

These heavy rains are unusual. Dense cloud bands have crossed the desert, carrying moisture evaporating from seas off north-west Australia. Rain has fallen across almost the entire continent in the last two weeks. Our rain events are usually regional – not national.

Why doesn’t Victoria have as many floods?

Victoria’s claim to fame in disasters is that it’s the most bushfire-prone region in the world (followed by California and Greece).

Fire risk also comes from climate. Victoria’s temperate climate means dry summers and less rain than its northern counterparts – around 520 millimetres of rain a year falls on average in Melbourne, compared to 1175mm a year in Sydney and 1149mm in Brisbane. Up north, rain tends to fall intensely, whereas Victoria’s rain tends to fall more as drizzle.

What’s different this time? September was wetter and colder than usual in Victoria, which meant the ground was already saturated in many areas. Colder weather means less water evaporates. Together, that made the state primed for floods.

For a flood to happen, you need a high rate of run-off, where rain hits saturated soils and flows overland rather than sinking in, as well as intense rains in a short period.

Victoria is more familiar with flash floods. That’s because the stormwater drains in cities and towns can be overwhelmed by sudden dumps of rain, flooding streets. The good news is this flooding is usually over quickly, in contrast to the flooded rivers we see up north.

This situation may be different. With the state’s major dams beyond capacity or very close to it, water is already spilling over. Dams in Australia are often dual-purpose, storing drinking water and allowing us some control over floods. While Brisbane’s dams are designed with gates to permit floodwater release, Victoria’s dams tend to just have dam walls.

When dams overflow, they can add to floods in low-lying areas downstream. There’s also usually a lag time in riverine floods, as it takes hours or sometimes days for rain falling in the headwaters to end up as floodwater downstream.

What floods has Victoria seen before?

The largest was in 1934. More than 140mm of rain fell over two days in Melbourne, and more than double that in Gippsland. The enormous flood that followed was most devastating in Melbourne, where the Yarra broke its banks and formed a lake from the city out to the outer suburbs. Thirty-six people died, and thousands of people were left homeless.

Floods in the capital and in the regions are rare but not unknown. In 1891, floods forced more than 3,000 people from their homes in Richmond, Collingwood and Prahran. In 1909, western Victorian rivers broke their banks, flooding many towns and causing four deaths.

flood melbourne 1891
A man rows across Toorak Road in the 1891 floods in Melbourne.
State Library Victoria, CC BY

The most recent big floods took place during the previous La Niña cycle from 2010-2012, with western Victoria taking the brunt of the damage.

Flooding in Victoria has also reduced because people have shifted the course of rivers – particularly the Yarra.

In 1879, 2,000 workers began a monster task: removing an entire loop of the Yarra west of the Docklands. One reason? Straight rivers flow faster, meaning floodwaters can discharge more quickly.

Engineer John Coode was responsible for designing the new course for the Yarra, which also had the benefit of a wide new channel to improve access for ships. In the process, his workers created what’s now known as Coode Island.

In 1896, Victoria’s Parliament passed the Yarra Improvement Act in a bid to reduce the damage caused by floods. Workers widened and deepened the river, and removed billabongs near the Botanic Gardens in the process.

In the 1930s, engineers built another channel through an old quarry leading to the creation of Herring Island. These changes were mainly about improving navigation for ships – but they had the double benefit of reducing flooding in the lower reaches. In part, it was about British ideals of what rivers should look like, using highly modified rivers like London’s Thames as a guide.

What’s next?

Changing the course of rivers, raising dams and building levees can make us feel like we’re in control. Unfortunately, it’s not that simple, as Lismore’s residents found.

Flood control measures can actually make the impact of large floods worse by giving us a false sense of security about living on floodplains.

This is unlikely to be the last flood before La Niña finally relents. It’s worth knowing your state’s history of disasters – so you can be better prepared. After all, we can’t control nature.




Read more:
On our wettest days, stormclouds can dump 30 trillion litres of water across Australia


The Conversation

Margaret Cook does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.

ref. Floods in Victoria are uncommon. Here’s why they’re happening now – and how they compare to the past – https://theconversation.com/floods-in-victoria-are-uncommon-heres-why-theyre-happening-now-and-how-they-compare-to-the-past-192391

Ressa ‘disappointed’ over failed appeal and ongoing harassment in Philippine cyber libel case

By Jairo Bolledo in Manila

The Philippines Court of Appeals has denied the motion for reconsideration filed by Nobel Peace Prize laureate and Rappler CEO Maria Ressa and former Rappler researcher Reynaldo Santos Jr. over their cyber libel case.

In a 16-page decision dated October 10, the court’s fourth division denied the appeal.

Associate Justices Roberto Quiroz, Ramon Bato Jr., and Germano Francisco Legaspi signed the ruling. They were the same justices who signed the court decision, which earlier affirmed the conviction of Ressa and Santos.

According to the court, the arguments raised by Ressa and Santos were already resolved.

“A careful and meticulous review of the motion for reconsideration reveals that the matters raised by the accused-appellants had already been exhaustively resolved and discussed in the assailed Decision,” the court said.

The court also claimed Ressa’s and Santos’ conviction is not meant to curtail freedom of speech.

“In conclusion, it [is] worthy and relevant to point out that the conviction of the accused-appellants for the crime of cyberlibel punishable under the Cybercrime Law is not geared towards the curtailment of the freedom of speech, or to produce an unseemingly chilling effect on the users of cyberspace that would possibly hinder free speech.”

‘Safeguard’ for free speech
On the contrary, the court said, the purpose of the law is to “safeguard the right of free speech, and to curb, if not totally prevent, the reckless and unlawful use of the computer systems as a means of committing the traditional criminal offences…”

In a statement, Nobel Peace laureate Ressa said she was “disappointed” but not surprised by the ruling.


Rappler’s video report on YouTube.

“The ongoing campaign of harassment and intimidation against me and Rappler continues, and the Philippines legal system is not doing enough to stop it. I am disappointed by today’s ruling but sadly not surprised,” Ressa said.

“This is a reminder of the importance of independent journalism holding power to account. Despite these sustained attacks from all sides, we continue to focus on what we do best — journalism.”

Santos, in a separate statement, said he still believed that the rule of law would prevail.

“The [Appeal Court’s] decision to deny our motion is not surprising, but it’s disheartening nevertheless. As we elevate our case to the SC, our fight against intimidation and suppression of freedom continues. We still believe that the rule of law will prevail.”

Theodore “Ted” Te, Rappler’s lawyer and former Supreme Court spokesperson, said they would now ask the Supreme Court to review and reverse Ressa’s conviction.

“The CA decision denying the MFR [motion for reconsideration] is disappointing. It ignored basic principles of constitutional and criminal law as well as the evidence presented. Maria and Rey will elevate these issues to the SC and we will ask the SC to review the decision and to reverse the decision,” Te said in a statement.

The decision
The Appeal Court also explained its findings on the arguments based on:

  • Applications of the provisions of cyber libel under the cybercrime law
  • Subject article should have been classified as qualifiedly privileged” in relation to Wilfredo Keng as a public figure

On the validity of the cybercrime law, the court cited a ruling which, according to them, decided the constitutionality of the law.

“We find it unnecessary to dwell on the issue raised by accused-appellants since the Supreme Court, in Jose Jesus M. Disini, Jr., et al., v. The Secretary of Justice, et al. (Disini Case), 5 had already ruled on its validity and constitutionality, with finality.”

The court also reiterated that the story in question was republished. The court said the argument that ex-post facto was applied on the theory that the correction of one letter is too unsubstantial and cannot be considered a republication is “unavailing.”

“As settled, the determination of republication is not hinged on whether the corrections made therein were substantial or not, as what matters is that the very exact libelous article was again published on a later date,” the appeals court said.

On the increase of penalty, the CA said the argument that Wilberto Tolentino v. People has no doctrinal value and cannot be used as a binding precedent as it was “an unsigned resolution, is misplaced.”

That case said the “prescriptive period for the crime of cyber libel is 15 years.”

Traditional, online publications
The appeals court also highlighted the difference between traditional and online publications: “As it is, in the instance of libel through traditional publication, the libelous article is only released and circulated once – which is on the day when it was published.”

Such was not the case for an online publication, the court said, where “the commission of such offence is continuous since such article remains therein in perpetuity unless taken down from all online platforms where it was published…”

On the argument about Keng, the CA said it was insufficient to consider him a public figure: “As previously settled, the claim that Wilfredo Keng is a renowned businessman, who was connected to several companies, is insufficient to classify him as a public figure.”

The term “public figure” in relation to libel refers more to a celebrity, it said, citing the Ciriaco “Boy” Guingguing v. Honorable Court of Appeals decision. The decision said a public figure is “anyone who has arrived at a position where public attention is focused upon him as a person.”

It also cited the Supreme Court decision on Alfonso Yuchengco v. The Manila Chronicle Publishing Corporation, et al., which resolved the argument whether a businessman can be considered a public figure. The court said that being a known businessman did not make Keng a public figure who had attained a position that gave the public “legitimate interest in his affairs and character.”

There was no proof, too, that “he voluntarily thrusted himself to the forefront of the particular public controversies that were raised in the defamatory article,” the CA added.

In 2020, Manila Regional Trial Court (RTC) Branch 46 convicted Ressa and Santos over cyber libel charges filed by Keng. The case tested the 8-year-old Philippine cybercrime law.

The Manila court interpreted the cyber libel law as having a 12-year proscription period, as opposed to only a year. The lower court also decided that republication was a separate offence.

Aside from affirming the Manila court’s ruling, the CA also imposed a longer prison sentence on Ressa and Santos, originally set for six months and one day as minimum to six years as maximum.

The appeals court added eight months and 20 days to the maximum imprisonment penalty.

Jairo Bolledo is a Rappler journalist. Republished with permission.

Print Friendly, PDF & Email

Article by AsiaPacificReport.nz

New MP marks milestone for Aotearoa – gender parity in the House

By Moana Ellis, Local Democracy Reporter

The swearing in of Labour list MP Soraya Peke-Mason to Parliament on October 25 will mark a milestone for women in Aotearoa New Zealand.

For the first time in its history, women in New Zealand’s Parliament will have an equal share of seats in the House.

“That’s quite significant,” Peke-Mason said. “It really shows the maturity of Aotearoa in terms of equity from a gender perspective.”

Local Democracy Reporting
LOCAL DEMOCRACY REPORTING

Prime Minister Jacinda Ardern said reaching the milestone was “significant and heartening”.

“Our Parliament will always be better when the diversity of voices in New Zealand are heard in our law making and government.

“The Labour Party in particular has been deeply committed to having equality of representation within our own caucus and we are really excited to welcome Soraya to our team.”

Peke-Mason will also be the first MP sworn in by the new Speaker, her cousin Te Tai Hauāuru MP Adrian Rurawhe, and the first new MP pledging allegiance to the new king, Charles III.

Sworn in with Te Reo
Representing the Rangitīkei electorate and supported by kaumātua and whānau from the river and mountain tribes and Rangitīkei, she will be sworn in at 2pm, in Te Reo Māori, and will give her maiden speech at 5.45pm.

“It is an honour and a privilege to be going to Parliament to represent our rohe,” Peke-Mason said.

“Over the last one or two decades my work has taken me across the Whanganui, the Ruapehu and the Rangitīkei districts.

“I’m excited and proud to be able to represent our rohe, and for Te Awa Tupua, for Rangitīkei, for all of us to have another strong voice at a table that makes really important and hard decisions on behalf of Aotearoa.”

It is two years since Peke-Mason missed out at the 2020 election. Her elevation to Parliament was announced in June after news that Kris Faafoi would leave politics and Trevor Mallard would move on to a diplomatic posting.

Peke-Mason, who lives at Rātana south of Whanganui, was Rangitīkei’s first wahine Māori councillor for 12 years until 2019, when she unsuccessfully ran for Horizons Regional Council.

In 2020, she stood in the general election in Rangitīkei against incumbent Ian McKelvie and was ranked No 60 on the Labour list.

‘You just get on with it’
“After the results of the last election, there was a possibility that I could enter Parliament but you just get on with it. You leave that there to the side and you just get on with your mahi at home.”

She was appointed to the Whanganui District Health Board and to its Hauora ā Iwi Relationship Board. She also helped lead the Whanganui Māori Regional Tourism board, was a member of Rangitīkei District Council’s Te Roopu Ahi Kā and held a number of iwi Māori and Māori trust governance roles.

“I’ve had plenty of time to be able to exit the work that I’ve been doing in the rohe, to tidy up those loose ends, to finish up projects properly, look at replacements, and work with Māori authorities that I’ve done work for to ensure there’s an appropriate exit process so that they’re not left in the lurch,” she said.

“And I’ve also been able to exit some of the boards I’ve been on.

“I’ve been lucky to have the time to do that. Not every MP gets that time.”

Public Interest Journalism funded through NZ On Air.

Print Friendly, PDF & Email

Article by AsiaPacificReport.nz

Fiji’s Methodists face ‘worrying trend’ over misuse of funds, dictatorial style

By Wata Shaw in Suva

Misuse of funds, dictatorial leadership and lack of consultation displayed by some Methodist Church leaders in Fiji is “a worrying trend”, says church president Reverend Ili Vunisuwai.

He highlighted this and lifestyle concerns — including the abuse of kava — during the Methodist Church in Fiji and Rotuma’s annual conference yesterday.

Reverend Vunisuwai said leadership without respect and humility would push the congregation to search for other places of worship where their voices could be heard.

“Reports and complaints have been received at the head office regarding the misuse of funds in our churches,” he said.

“This is a serious concern as it can end up in the court of law.

“I hereby plead to uphold our Christian values with respect and humility to move forward in improving the leadership status of our church.”

Reverend Vunisuwai also emphasised the need for church members to be mindful of their lifestyles as many ministers had died prematurely.

“Some have passed on while others have been affected with non-communicable diseases (NCDs),” he said.

“We need to be mindful of our lifestyle, especially our eating habits, excessive consumption of kava, staying up late at night, and not having enough rest.”

He called on the congregation to implement the three pillars of the church’s 10-year strategic plan — physical well-being, good leadership and creating awareness for climate change.

Wata Shaw is a Fiji Times reporter. Republished with permission.

Print Friendly, PDF & Email

Article by AsiaPacificReport.nz

Vanuatu snap election: International observers arrive for key vote

By Hiliare Bule, RNZ News correspondent in Port Vila

Forty nine regional and international observers have arrived in Vanuatu to monitor the running of the country’s snap election tomorrow.

The election was triggered after the dissolution of the country’s Parliament on August 19 by President Nikenike Vurobaravu, and on the eve of a motion of no-confidence against the now caretaker prime minister Bob Loughman.

More than 300,000 people are expected to cast their vote in the snap election.

The Chairman of the Electoral Commission, Edward Kaltamat, has confirmed observers from Australia, China, Fiji, France, Kiribati, Melanesian Spearhead Group Secretariat, New Zealand, Pacific Islands Forum, United Kingdom and the United Nations are in the country.

Kaltamat said their presence will provide confidence to the voters on the transparency and credibility of the election.

The 49 observers have signed their code of conduct to guide them while they are in the field.

Kaltamat said some of them would stay in the capital to monitor the elections in Port Vila and the Efate constituency, and some would be deployed in the islands.

He said the observers will be briefed before being sent to the islands by aircraft.

This is not the first time that international observers have monitored an election in Vanuatu.

This article is republished under a community partnership agreement with RNZ.

Print Friendly, PDF & Email

Article by AsiaPacificReport.nz

Star Post-Courier ‘frontline’ reporter Miriam Zarriga now new chief-of-staff

PNG Post-Courier

Miriam Zarriga, one of Papua New Guinea’s top experienced journalists, has been appointed as the PNG Post-Courier’s new chief-of-staff.

With more than 10 years working with the Post-Courier, Zarriga has extensive experience in political, security and general news reporting.

She replaces Lawrence Fong, a fellow stalwart of the Post-Courier who has held the position of chief-of-staff for the last three years.

Fong welcomed Zarriga’s appointment and issued his unwavering support on behalf of the newsroom as she moves into her new role. He now shifts to become online content editor of the masthead.

Prior to her appointment, Zarriga played a key role in Post-Courier’s 2022 National General Election coverage alongside senior political journalist Gorethy Kenneth.

Her involvement provided extensive election coverage on election-related violence around the country, and in some cases facing the brunt of tribal warfare in daring situations.

‘No walk in the park’
Post-Courier’s
editor Matthew Vari congratulated Zarriga on her appointment, saying the role embodied the challenges of running a modern newsroom.

“The chief-of-staff position is no walk in the park,” Vari said. “But I have every confidence in Ms Zarriga’s capabilities in ensuring we produce the best content for our readers.

“Her experience over the many years on the frontline of mainstream media provides Ms Zarriga with a wealth of understanding of what’s needed to be produced for our readers.”

The chief-of-staff role handles the content of the newspaper, and the day-to-day operations of the newsroom and its reporters.

Republished with permission.

Print Friendly, PDF & Email

Article by AsiaPacificReport.nz

How Philippine ‘press freedom’ has been abandoned under ‘Bongbong’ Marcos

ANALYSIS: By Danilo Arana Arao in Manila

Upon assuming the Philippines presidency on 30 June 2022, Ferdinand “Bongbong” Marcos Jr — the only son and namesake of the former dictator Ferdinand Marcos — delivered an inaugural address that did not mention press freedom.

Press freedom also went unmentioned when he delivered his first State of the Nation Address before the joint Senate and House of Representatives on 25 July 2022.

His silence on the issue was notable given that the former press secretary Trixie Cruz-Angeles, who stepped down on 4 October 2022 due to health reasons, had stressed that press freedom would be guaranteed under the Marcos Jr administration and that the administration would “work closely” with news media.

But as he pledged to protect press freedom on the campaign trail, certain journalists were pushed for getting too physically close to Marcos Jr.

It also remains to be seen whether his representatives will continue to evade critical questions during press briefings or if Marcos Jr will be more accommodating of interview requests. The normalisation of these practices would be a death knell for press freedom in the Philippines.

Media restrictions and abuse under Marcos Jr evoke memories of the Philippine media’s dark history under former Philippines president and dictator Ferdinand Marcos’ martial law from 1972–86.

The Center for Media Freedom and Responsibility identifies five similarities between the Marcos regime in the 1970s and the current Marcos Jr administration.

Distribution of propaganda
These are the distribution of propaganda through government agencies and social media, the ABS–CBN shutdown, attacks and threats against journalists, crony press and media selectivity and propaganda films.

There are chilling similarities between the two administrations despite Marcos Jr’s promise that he would not declare martial law.

For the current administration, “working closely” with journalists means putting them in touch with pro-Marcos Jr vloggers, content creators and influencers. Cruz-Angeles is prioritising the accreditation of pro-regime reporters to cover official functions.

But her claim that accreditation is open to those of all political beliefs rings untrue as pro-Marcos Jr vloggers recently established a new group (upon the suggestion of Cruz-Angeles herself) to help gain government accreditation.

Celebrity vlogger Toni Gonzaga was granted a one-on-one interview with Marcos Jr at the Malacañang Palace in September 2022, showing how the administration accommodates those who ask soft questions. That reminds many Filipinos of Marcos Jr’s non-participation in most presidential debates and interviews during the campaign, opting to accommodate events organised by his supporters.

During the 2022 election campaign, there were times when his handlers did not invite critical journalists, asking those invited to submit questions in advance to control the flow of press briefings.

By accrediting pro-administration, hyper-partisan non-journalists, the Marcos Jr administration gives them legitimacy as “truth seekers” even if there is evidence they proliferate disinformation. It is also a strategy to discredit critical journalists for peddling “fake news”.

Critical journalists harassed
Critical journalists and media organisations are harassed and intimidated under the Marcos Jr administration, just as they were under the 2016–2020 Duterte administration. Disinformation remains rampant even after the 2022 elections.

Red-tagging — the blacklisting of journalists and media outlets critical of the government — has continued.

Shortly after Marcos Jr assumed the presidency, the Court of Appeals upheld the “cyber libel” convictions of Nobel Prize laureate Maria Ressa and former Rappler writer Reynaldo Santos Jr.

While these convictions appeared to carry over the selective harassment and intimidation of the vengeful Duterte administration, the chilling effect on the media is real. Those targeted become grim reminders of what can happen if journalists and news media organisations incur the ire of the powers that be.

The date 21 September 2022 marked the 50 years since martial law was imposed. Marcos Jr repeatedly claims martial law was necessary to tackle communist and separatist threats, dismissing accusations that his father was a dictator.

Even the funding for the planned memorial for Martial Law victims was cut by 75 percent in the 2023 National Expenditure Programme.

Marcos Jr intends to rewrite history textbooks to include his family’s version of the truth. By silencing his critics, he can further engage in historical denialism. This is important not just to erase his father’s dictator image but to escape his family’s legal problems like the unpaid estate tax and his mother’s conviction for seven counts of graft.

Media repression ‘normalised’
Media repression continues to be normalised under the Marcos Jr regime. One of his allies in the House of Representatives blocked the return of ABS–CBN, whose franchise bid was denied in 2020. Rappler and its editorial staff, including Ressa, continue to face legal problems as well as the threat of closure.

The National Telecommunications Commission blocked 27 websites accused of having communist links in June 2022. It took a court order for the online publication Bulatlat Multimedia to be unblocked, while journalist Frenchie Mae Cumpio remains in detention on questionable charges after being red-tagged and subjected to death threats.

The murder of broadcaster Percy Lapid on 3 October 2022 — the second journalist to be killed under the new administration — also reflects the dire state of press freedom in the Philippines.

That Marcos Jr did not mention press freedom in his inaugural speech and first State of the Nation Address reflects his disregard for critical journalism.

Although it is still early days, his efforts to whitewash the dictatorship’s dark past and continue his predecessor’s media repression indicate that his pre-election promise of a “free press” is long abandoned.

Danilo Arana Arao is associate professor at the Department of Journalism, the University of the Philippines Diliman, special lecturer at the Department of Journalism, the Polytechnic University of the Philippines Santa Mesa, associate editor at Bulatlat Multimedia and editor at Media Asia. This article was first published in East Asia Forum.

Print Friendly, PDF & Email

Article by AsiaPacificReport.nz

740,000km of fishing line and 14 billion hooks: we reveal just how much fishing gear is lost at sea each year

Source: The Conversation (Au and NZ) – By Britta Denise Hardesty, Senior Principal Research Scientist, Oceans and Atmosphere, CSIRO

Bo Eide/CSIRO, Author provided

Two per cent of all fishing gear used worldwide ends up polluting the oceans, our new research finds. To put that into perspective, the amount of longline fishing gear littering the ocean each year can circle the Earth more than 18 times.

We interviewed 450 fishers from seven of the world’s biggest fishing countries including Peru, Indonesia, Morocco and the United States, to find out just how much gear enters the global ocean. We found at current loss rates, in 65 years there would be enough fishing nets littering the sea to cover the entire planet.

This lost fishing equipment, known as ghost gear, can cause heavy social, economic and environmental damage. Hundreds of thousands of animals are estimated to die each year from unintentional capture in fishing nets. Derelict nets can continue to fish indiscriminately for decades.

Our research findings help highlight where to focus efforts to stem the tide of fishing pollution. It can also help inform fisheries management and policy interventions from local to global scales.

Fishing boats in port near Lima, Peru.
CSIRO

14 billion longline hooks litter the sea each year

The data we collected came directly from fishers themselves. They experience this issue firsthand and are best poised to inform our understanding of fishing gear losses.

We surveyed fishers using five major gear types: gillnets, longlines, purse seine nets, trawl nets, and pots and traps.

We asked how much fishing gear they used and lost annually, and what gear and vessel characteristics could be making the problem worse. This included vessel and gear size, whether the gear contacts the seafloor, and the total amount of gear used by the vessel.

We coupled these surveys with information on global fishing effort data from commercial fisheries.

Man uses longline on a boat
Longlines are deep-sea fishing lines that trail behind a boat, and are made up of many short lines with baited hooks that come off of each ‘long’ line. Vessels may have from 25 to 2,500 hooks or more for each line.
Shutterstock

Fishers use different types of nets to catch different types of fish. Our research found the amount of nets littering the ocean each year include:

  • 740,000 kilometres of longline mainlines
  • nearly 3,000 square kilometres of gill nets
  • 218 square kilometres of trawl nets
  • 75,000 square kilometres of purse seine nets

In addition, fishers lose over 25 million pots and traps and nearly 14 billion longline hooks each year.

Fisher in red gloves pulling a net into their boat
At the current pollution rate, fishing nets littering the ocean could cover the entire planet in 65 years.
Shutterstock

These estimates cover only commercial fisheries, and don’t include the amount of fishing line and other gear lost by recreational fishers.

We also estimate that between 1.7% and 4.6% of all land-based plastic waste travels into the sea. This amount likely exceeds lost fishing gear.

However, fishing gear is designed to catch animals and so is generally understood as the most environmentally damaging type of plastic pollution in research to date.


Countries (in black) where interviews with fishers occurred. Fishers were surveyed from each of the seven key marine regions/continents of the world, excluding Antarctica. The number of surveys conducted for major gear types/fisheries are listed (bullet points) below each country name.


Harming fishers and marine life

Nearly 700 species of marine life are known to interact with marine debris, many of which are near threatened. Australian and US research in 2016 found fishing gear poses the biggest entanglement threats to marine fauna such as sea turtles, marine mammals, seabirds and whales.

Other marine wildlife including sawfish, dugong, hammerhead sharks and crocodiles are also known to get entangled in fishing gear. Other key problematic items include balloons and plastic bags.




Read more:
We composted ‘biodegradable’ balloons. Here’s what we found after 16 weeks


Lost fishing gear is not only an environmental risk, but it also has an economic impact for the fishers themselves. Every metre of lost net or line is a cost to the fisher – not only to replace the gear but also in its potential catch.

Additionally, many fisheries have already gone through significant reforms to reduce their environmental impact and improve the sustainability of their operations.

2% of fishing gear used worldwide gets lost at sea.
Denise Hardesty, Author provided

Some losses are attributable to how gear is operated. For instance, bottom trawl nets – which can get caught on reefs – are lost more often that nets that don’t make contact with the sea floor.

The conditions of the ocean can also make a significant difference. For example, fishers commonly reported that bad weather and overcrowding contributes to gear losses. Conflicts between gears coming into contact can also result in gear losses, such as when towed nets cross drifting longlines or gillnets.

Where fish are depleted, fishers must expend more effort, operate in worse conditions or locations, and are more likely to come in contact with others’ gear. All these features increase losses.

Crab traps
Pots/traps such as these are used to catch crabs and lobsters.
Shutterstock

What do we do about it?

We actually found lower levels of fishing gear losses in our current study than in a previous review of the historical literature on the topic. Technological improvements, such as better weather forecasts and improved marking and tracking of fishing gear may be reducing loss rates.

Incentives can further reduce losses resulting in ghost gear. This could include buyback programs for end-of-life fishing gear, reduced cost loans for net replacement, and waste receptacles in ports to encourage fishers to return used fishing gear.

Technological improvements and management interventions could also make a difference, such as requirements to mark and track gear, as well as regular gear maintenance and repairs.

Developing effective fishing management systems can improve food security, leave us with a healthier environment, and create more profitable businesses for the fishers who operate in it.




Read more:
These are the plastic items that most kill whales, dolphins, turtles and seabirds


The Conversation

Britta Denise Hardesty receives funding from numerous federal and philanthropic organisations for plastic pollution related work, including on abandoned, lost and derelict fishing gear (ALDFG).

Chris Wilcox receives funding from the CSIRO, Australian Department of Foreign Affairs and Trade, and the National Philanthropic Trust. He is affiliated with the Minderoo Foundation.

Joanna Vince receives funding from the Australian Research Council and the Australian National Science Environment Program.

Kelsey Richardson received funding from CSIRO and the University of Tasmania to support this research.

ref. 740,000km of fishing line and 14 billion hooks: we reveal just how much fishing gear is lost at sea each year – https://theconversation.com/740-000km-of-fishing-line-and-14-billion-hooks-we-reveal-just-how-much-fishing-gear-is-lost-at-sea-each-year-192024

Politics with Michelle Grattan: Rod Sims on tax reform and the gas price crisis

Source: The Conversation (Au and NZ) – By Michelle Grattan, Professorial Fellow, University of Canberra

The government has flirted with, and now ruled out, changing the Stage 3 tax cut in the October 25 budget, which appears set to be dominated by some deep spending cuts. In the longer term, however, debate will continue over the need to reform Australia’s tax system, as the calls on revenue to finance big programs increase.

Meanwhile, the government is locked in a battle to get high domestic gas prices down, with its light touch policy towards the gas producers not having much impact.

In this podcast, Michelle Grattan talks with Rod Sims, former chair of the Australian Competition and Consumer Commission (ACCC), and now a professor at the Australian National University’s Crawford School for Public Policy, on tax, gas and privatisation.

Sims says tax reform should look beyond income tax. “We have plenty of other ways to raise taxation […] we should be altering the existing petroleum resource rent tax because I think it’s flawed and we can get more money out of that pretty well straight away”. This change could raise “billions per year”.

Advocating a more robust taxing of resources, Sims says: “You’ve got high mineral prices, high gas prices all around the world. That’s causing harm in Australia as well as elsewhere. Yet we’re not we’re not getting enough tax from them. I think that’s a really unhealthy situation to be in.”

Sims also criticises the way privatising state assets has been done, and urges changes for the future to ensure competition.

“We should stop privatising assets in ways that see monopolies in private hands without any regulation and often with arrangements to stop them facing competition. I think we’ve got to have tests for making sure we do these things in a competitive way with proper regulation […] if you have three bread shops that you can buy bread from, you get a much better deal than if the only choice you have is one bread shop.”

The Conversation

Michelle Grattan does not work for, consult, own shares in or receive funding from any company or organization that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.

ref. Politics with Michelle Grattan: Rod Sims on tax reform and the gas price crisis – https://theconversation.com/politics-with-michelle-grattan-rod-sims-on-tax-reform-and-the-gas-price-crisis-192340

When the face reacts, dermal fillers and COVID infection or vaccination are not a pretty combination

Source: The Conversation (Au and NZ) – By Michael Freeman, Dermatologist, Associate Professor, Bond University

Pexels/Youssef Labib, CC BY-SA

The growing list of COVID complications is long and surprising – from brain changes and heart disease to skin rashes and COVID toes.

Those who get dermal fillers injected into their face have the possibility of an additional complication: swelling and discomfort if they get COVID or a dose of a COVID vaccine. So should they take extra precautions, or time their treatments?

What are dermal fillers?

Fillers are now one of the most common non-surgical cosmetic procedures. Adding fillers to the face can address facial drooping; injections into the high cheekbone area lift the face.

Today’s patients might receive soft fillers in the lips and mouth areas, combined with botulinum toxins (botox) in overactive facial muscles, and lasers and light sources on the skin.

Dermal fillers are used to address facial asymmetry, which can cause functional, psychological/social, and reduced quality-of-life issues. Cosmetically, dermal fillers may give an immediate confidence boost.

Soft tissue fillers are usually hyaluronic acid products. Some other formulations that stimulate tissues are also used.

Fillers can only be prescribed by a registered medical practitioner.

Although soft tissue fillers are considered safe, several studies have shown complications occur with all filler types. Delayed inflammatory reactions – such as red and/or firm lumps possibly with swelling – are among the most common. The cause of these reactions is unknown, so treatments will vary.




Read more:
8 ways the coronavirus can affect your skin, from COVID toes, to rashes and hair loss


Puffy reactions

From 2020 to August 2021 there were around 19 reports in the medical literature of late inflammatory reactions post COVID or post vaccine occurring between weeks and years after filler treatment. This equates to an incidence range of 0.01% to 4.25% of soft tissue filler procedures. Not all cases are reported.

The reason for such reactions is not fully understood. There are many theories on how they can occur including immune reactions to filler triggered by infection, trauma or vaccination.

So, it is not surprising that in the current COVID pandemic, late inflammatory reactions have been reported after infection with SARS-CoV-2 (the virus that causes COVID) and vaccination to protect against it.

The first results of the US Food and Drug Administration (FDA) on the Moderna vaccine showed adverse events in three patients with soft tissue fillers. Such complications can occur between 15 days and six months after filler injections. And they can occur three to four weeks after COVID infection. Filler complications can begin quickly after receiving a mRNA COVID vaccination, between 13 hours and three weeks post-injection.

Clinical symptoms are redness, swelling, formation of lumps and discomfort in the filled areas. Some of the patients with reported complications have had a history of spontaneous facial swelling after a filler injection, previous vaccinations, or after other medical treatments.

It is not the first time adverse events after filler treatment have been reported after a viral infection, for example after an influenza-like illnesses.

The condition generally has a good response to oral corticosteroids, while some patients need hyaluronidase injections to dissolve the filler.

It has been suggested treatment with an angiotensin-converting enzyme inhibitor (ACE-1, usually prescribed to manage blood pressure), which plays a crucial role in SARS-CoV-2 binding properties, can reduce swelling in late inflammatory reactions.

Genetic factors are likely to play a role in who gets complications after dermal filler injections generally, with studies pinpointing the genes responsible in those who experience reactions. These individuals might have a lower threshold to infections, vaccines, or other factors that trigger an immune response.

What patients can do

Although small in number, the cases so far show adverse reactions with soft tissue filler occur after COVID infection and vaccination. The relationship between these factors seems likely, as they occur within a few hours or up to several weeks afterwards.

To prevent possible complications, the following recommendations have been suggested for those wishing to proceed with a filler:

  • ideally, allow a two- to four-week window between filler injections and vaccination in general, and two months longer for immunocompromised patients (those taking immunosuppressive medications, having chemotherapy, or with immune disorders) or after COVID infection

  • proceed with caution if there is a history of allergies, filler-related adverse events or problems after other types of implants

  • because vaccination protects against severe COVID, long COVID and death, delay the filler rather than the vaccination

  • if a reaction does occur, then your doctor can consider starting treatment with oral steroids, provided there is no infection.




Read more:
Friday essay: toxic beauty, then and now


The Conversation

Michael Freeman is the founder of The Skin Centre, a private dermatology practice which also offers dermal fillers.

ref. When the face reacts, dermal fillers and COVID infection or vaccination are not a pretty combination – https://theconversation.com/when-the-face-reacts-dermal-fillers-and-covid-infection-or-vaccination-are-not-a-pretty-combination-192159

Mind the gap: gender differences in time use narrowing, but slowly

Source: The Conversation (Au and NZ) – By John Hawkins, Senior Lecturer, Canberra School of Politics, Economics and Society, University of Canberra

Shutterstock

The Australian Bureau of Statistics has released its first time-use survey in 15 years. The last time it collected such data, in 2006, Apple was yet to release the iPhone and Facebook was a start-up.

So much has changed, though the differences in time use between men and women have not changed as much as many might like.

The new survey suggests we’re spending an average of 4 hours 23 minutes a day watching video, listening to audio or some other activity involving a computer or handheld device.

The average full-time worker spent 8 hours 44 minutes a day on employment-related activities. But we’re getting pretty much the same amount of sleep – about 8½ hours on average for both men and women.

The survey suggests a slight narrowing in gender differences – but with domestic and caring responsibilities still principally undertaken by women.

Caution, however, is needed in interpreting these new results. The data was collected from 2,000 households between November 2020 and July 2021. So the times reported reflect the COVID-19 pandemic, with closed borders, restrictions and lockdowns. These were not ‘normal’ times.

Comparisons with the past data (from 2006, 1997, 1992 and the 1987 pilot study) are further complicated by the bureau warning the new figures “are not fully comparable with previous collections due to changes in methodology”.

With this in mind, let’s take a look.

How we use our time

Our first graph shows how men and women, on average, spend their days.

Necessary activities are things like sleeping, eating and personal care.
Contracted activities are things such as paid work and education. Committed activities cover unpaid domestic chores, child care, adult care and voluntary work. Free time means exactly that.


Made with Flourish

These times add up to over 24 hours. This is because many people spend part of their day doing two things at once. For example, while at work or driving or having breakfast (what the bureau terms a “primary” activity), they may be listening to the radio (a “secondary” activity).

Nonetheless they provide a useful snapshot – with men spending more time on paid work, and women more time on unpaid work.

When we’re working

Most of us who work do so during standard office or trading hours. But about a tenth of all workers were working between 8 pm and 10 pm at the time of the survey – either because they were shift workers or due to (paid or unpaid) overtime.


Made with Flourish

Time on domestic chores

On average women spent 3 hours 22 minutes a day on domestic responsibilities, compared with 2 hours 19 minutes for men. (Child-care responsibilities were on top of this – an average of 1 hour 26 minutes for women, 40 minutes for men.)


Made with Flourish

The time-use survey also reports these activities by participation rate and by average time spent by those who undertake such activities.

The percentage of men reporting doing any domestic activities was 84%, compared with 94% of women. Participation differences were particularly pronounced in housework (72% of women compared with 44% of men) and cooking (77% of women compared with 56% of men).

Among those who reported doing these activities, women spent an average 3 hours 36 minutes compared with an average 2 hours 46 minutes for men.

How we use our leisure time

In its 2006 survey the ABS reported five main categories for how people spent their leisure time: sport and other outdoor activities; games, hobbies, arts and crafts; talking, writing or reading correspondence; using audiovisual media; and “other” activities.

This survey has updated procedures to ensure greater clarity around our burgeoning consumption of various types of media – recording times for listening to music and podcasts; games and puzzles; video games; and general internet and device use.


Made with Flourish

Feeling under pressure

Perhaps not surprisingly, more women than men reported feeling “rushed or pressed for time”. These stresses were particularly prevalent among parents with children at home.


Made with Flourish

Are gender differences narrowing?

While comparison with past surveys is complicated for the reasons mentioned, gender differences do appear to have narrowed, with men doing a little more housework.


Made with Flourish

This is consistent with international studies suggesting “some signs of gender convergence, with a widespread decrease in women’s housework … and increases in men’s housework and childcare”.

However, with comparisons with earlier years being muddied by the pandemic and changes to coding procedures, we will have to wait for the next time-use survey for a clearer picture.

Hopefully it won’t be 15 years.

The Conversation

Michael Walsh worked at the Australian Bureau of Statistics (ABS) between 2011 and 2015. Michael has no ongoing employment or financial links with the ABS.

John Hawkins does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.

ref. Mind the gap: gender differences in time use narrowing, but slowly – https://theconversation.com/mind-the-gap-gender-differences-in-time-use-narrowing-but-slowly-191678

NASA’s asteroid deflection mission was more successful than expected. An expert explains how

Source: The Conversation (Au and NZ) – By Steven Tingay, John Curtin Distinguished Professor (Radio Astronomy), Curtin University

NASA/ESA/STScI/Hubble

On September 26, after a nine-month journey through the Solar System, NASA’s Double Asteroid Redirection Test (DART) mission impacted an asteroid called Dimorphos.

NASA scored a bullseye, with DART – roughly the size of a vending machine – hitting Dimorphos within 10% of the 160-metre asteroid’s centre. The hit changed the orbit of Dimorphos around its bigger companion asteroid Didymos by more than 30 minutes, far exceeding the original goal.

This is the first time humans have deliberately changed the motion of a significant Solar System object. The test shows it’s plausible to protect Earth from asteroid impacts using similar future missions, if needed.




Read more:
In a world first, NASA’s DART mission is about to smash into an asteroid. What will we learn?


A grayscale rock suspended in air on a dark background
The Italian Space Agency’s LICIACube spacecraft acquired this image just before its closest approach to the Dimorphos asteroid, after the impact. Didymos, Dimorphos, and the plume of debris ejected from Dimorphos are clearly visible.
ASI/NASA

An astonishing feat

The successful mission is an astonishing feat of science and engineering. In the final phases of approach before impact, DART autonomously steered itself to the impact site, processing images onboard the spacecraft and adjusting its trajectory without the intervention of humans.

Many telescopes on Earth, and an Italian spacecraft that tagged along with DART, were able to obtain amazing images of the impact. Even small telescopes captured spectacular views, showing an enormous plume of debris from the impact that developed into a trail now following the asteroid through space.

The DART mission was the first test of planetary defence – the use of a spacecraft to change the trajectory of an asteroid.

In the future, such a technique could protect Earth from asteroid impact, if we detect an asteroid on a collision course with us. By changing the direction of an asteroid when it is far from Earth, a collision could be avoided.

A blue streak on a dark background with compass arrows showing North and East
NASA’s Hubble Space Telescope shows Dimorphos 285 hours after the impact, with a tail of debris generated by the impact.
NASA/ESA/STScI/Hubble

How was DART so successful?

Dimorphos was chosen as the target for DART because it is part of a double asteroid system – it orbits a larger, 780-metre asteroid called Didymos. Before the impact, this orbit was very regular and could be measured by large telescopes from Earth. Measurements showed the period of the orbit was about 11 hours and 55 minutes.

The DART mission goal was to show the orbit of Dimorphos would be changed by the impact, which took place 11 million kilometres from Earth, with the spacecraft travelling at 25,000 kilometres per hour.

A zoomed-in view of the orbit of Dimorphos around Didymos. Astronomers can measure the orbit by detecting dips in the brightness of the light the asteroid pair reflect from the Sun. A small dip occurs when Dimorphos eclipses Didymos, and a bigger dip the other way around.
NASA/APL/UMD

Telescopes on Earth measured the orbit before and after the impact. The minimum change to the orbit to declare mission success was 73 seconds.

The data are in and DART changed the orbit of Dimorphos by a whopping 32 minutes (plus or minus 2 minutes).

The change is large, partly because of the resulting debris plume. The act of throwing all that debris off the asteroid generated a recoil, like the recoil of a gun; the bullet is fired in one direction and the gun recoils in the opposite direction. It’s the same with the debris plume and the asteroid.

A glowing point of light on a dark background with a streak extending to one side
A side view of the streams of material from the surface of Dimorphos two days after impact. On the right, the material is forming a more than 9,500-kilometre-long comet-like tail, pushed into shape by pressure from the Sun’s radiation.
CTIO/NOIRLab/SOAR/NSF/AURA/T. Kareta (Lowell Observatory), M. Knight (US Naval Academy)

Good news for planetary defence

By any measure, DART has therefore been a huge success. DART made a bullseye and showed that missions like this can alter the trajectories of asteroids. The idea has been around for a long time, and has inspired many asteroid movies. Now, engineering and science have caught up.

If, in the future, an asteroid is found to be on a collision path with Earth, and we have enough warning, a next-generation mission based on the DART experience could well save Earth and humanity from significant losses.

DART cost approximately US$324 million, and at this point it looks like money well spent.

As more data on the impact are analysed, planetary defence techniques can be refined. We will also learn a lot about asteroids from the data collected. A European mission is planned to go to the Didymos/Dimorphos system and take a close look at the impact crater, which will provide even more detailed information.




Read more:
Don’t look up: several asteroids are heading towards Earth – here’s how we deal with threats in real life


The Conversation

Steven Tingay is a member of the Australian Labor Party.

ref. NASA’s asteroid deflection mission was more successful than expected. An expert explains how – https://theconversation.com/nasas-asteroid-deflection-mission-was-more-successful-than-expected-an-expert-explains-how-192334

AI image generation is advancing at astronomical speeds. Can we still tell if a picture is fake?

Source: The Conversation (Au and NZ) – By Brendan Paul Murphy, Lecturer in Digital Media, CQUniversity Australia

Brendan Murphy, Author provided

Fake photography is nothing new. In the 1910s, British author Arthur Conan Doyle was famously deceived by two school-aged sisters who had produced photographs of elegant fairies cavorting in their garden.

Black and white image of a girl surrounded by paper cutouts of fairies
The first of the five ‘Cottingley Fairies’ photographs, taken by Elsie Wright in 1917.
Wikipedia

Today it is hard to believe these photos could have fooled anybody, but it was not until the 1980s an expert named Geoffrey Crawley had the nerve to directly apply his knowledge of film photography and deduce the obvious.

The photographs were fake, as later admitted by one of the sisters themselves.

A slightly uncanny image of a smiling man holding an oldschool photography camera
In 1982 Geoffrey Crawley deduced the fairy photographs were fake. So is this one.
Brendan Murphy, Author provided

Hunting for artefacts and common sense

Digital photography has opened up a wealth of techniques for fakers and detectives alike.

Forensic examination of suspect images nowadays involves hunting for qualities inherent to digital photography, such as examining metadata embedded in the photos, using software such as Adobe Photoshop to correct distortions in images, and searching for telltale signs of manipulation, such as regions being duplicated to obscure original features.

Sometimes digital edits are too subtle to detect, but leap into view when we adjust the way light and dark pixels are distributed. For example, in 2010 NASA released a photo of Saturn’s moons Dione and Titan. It was in no way fake, but had been cleaned up to remove stray artefacts – which got the attention of conspiracy theorists.

Curious, I put the image into Photoshop. The illustration below recreates roughly how this looked.

Screenshot of an image editing screen with charts for dark and light adjustment
A simulation showing how editing can be detected when levels of light and dark are adjusted.
Brendan Murphy, Author provided

Most digital photographs are in compressed formats such as JPEG, slimmed down by removing much of the information captured by the camera. Standardised algorithms ensure the information removed has minimal visible impact – but it does leave traces.

The compression of any region of an image will depend on what is going on in the image and current camera settings; when a fake image combines multiple sources, it is often possible to detect this by careful analysis of the compression artefacts.

Some forensic methodology has little to do with the format of an image, but is essentially visual detective work. Is everyone in the photograph lit in the same way? Are shadows and reflections making sense? Are ears and hands showing light and shadow in the right places? What is reflected in people’s eyes? Would all the lines and angles of the room add up if we modelled the scene in 3D?

Arthur Conan Doyle may have been fooled by fairy photos, but I think his creation Sherlock Holmes would be right at home in the world of forensic photo analysis.

A new era of artificial intelligence

The current explosion of images created by text-to-image artificial intelligence (AI) tools is in many ways more radical than the shift from film to digital photography.

We can now conjure any image we want, just by typing. These images are not frankenphotos made by cobbling together pre-existing clumps of pixels. They are entirely new images with the content, quality and style specified.




Read more:
AI art is everywhere right now. Even experts don’t know what it will mean


Until recently the complex neural networks used to generate these images have had limited availability to the public. This changed on August 23 2022, with the release to the public of the open-source Stable Diffusion. Now anyone with a gaming-level Nvidia graphics card in their computer can create AI image content without any research lab or business gatekeeping their activities.

This has prompted many to ask, “can we ever believe what we see online again?”. That depends.

Text-to-image AI gets its smarts from training – the analysis of a large number of image/caption pairs. The strengths and weaknesses of each system are in part derived from just what images it has been trained on. Here is an example: this is how Stable Diffusion sees George Clooney doing his ironing.

A slightly uncanny image of a man with distorted features holding a white towel
This is George Clooney doing his ironing… or is it?
Brendan Murphy, Author provided

This is far from realistic. All Stable Diffusion has to go on is the information it has learned, and while it is clear it has seen George Clooney and can link that string of letters to the actor’s features, it is not a Clooney expert.

However, it would have seen and digested many more photos of middle-aged men in general, so let’s see what happens when we ask for a generic middle-aged man in the same scenario.

A slightly uncanny image of a middle-aged man with rounded features looking at the camera and holding a shirt
Not-George-Clooney doing his ironing.
Brendan Murphy, Author provided

This is a clear improvement, but still not quite realistic. As has always been the case, the tricky geometry of hands and ears are good places to look for signs of fakery – although in this medium we are looking at the spatial geometry rather than the tells of impossible lighting.

There may be other clues. If we carefully reconstructed the room, would the corners be square? Would the shelves make sense? A forensic expert used to examining digital photographs could probably make a call on that.




Read more:
Cyber CSI: the challenges of digital forensics


We can no longer believe our eyes

If we extend a text-to-image system’s knowledge, it can do even better. You can add your own described photographs to supplement existing training. This process is known as textual inversion.

Recently, Google has released Dream Booth, an alternative, more sophisticated method for injecting specific people, objects or even art styles into text-to-image AI systems.

This process requires heavy-duty hardware, but the results are staggering. Some great work has begun to be shared on Reddit. Look at the photos in the post below that show images put into DreamBooth and realistic fake images from Stable Diffusion.



We can no longer believe our eyes, but we may still be able to trust those of forensics experts, at least for now. It is entirely possible that future systems could be deliberately trained to fool them too.

We are rapidly moving into an era where perfect photographic and even video will be common. Time will tell how significant this will be, but in the meantime it is worth remembering the lesson of the Cottingley Fairy photos – sometimes people just want to believe, even in obvious fakes.




Read more:
From epic storm pics to fairies in the garden, be careful with images


The Conversation

Brendan Paul Murphy does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.

ref. AI image generation is advancing at astronomical speeds. Can we still tell if a picture is fake? – https://theconversation.com/ai-image-generation-is-advancing-at-astronomical-speeds-can-we-still-tell-if-a-picture-is-fake-191674

Women-led protests in Iran gather momentum – but will they be enough to bring about change?

Source: The Conversation (Au and NZ) – By Tony Walker, Vice-chancellor’s fellow, La Trobe University

Protests following the death of Iranian woman Mahsa Amini have spread to other countries, including Lebanon. Wael Hamzeh/EPA/AAP

As protests in Iran drag on into their fourth week over the violent death in custody of Mahsa Amini, a young Kurdish woman, there are two central questions.

The first is whether these protests involving women and girls across Iran are different from upheavals in the past, or will simply end the same way with the regime stifling a popular uprising.

The second question is what can, and should, the outside world do about extraordinarily brave demonstrations against an ageing and ruthless regime that has shown itself to be unwilling, and possibly unable, to allow greater freedoms?

The symbolic issue for Iran’s protest movement is a requirement, imposed by morality police, that women and girls wear the hijab, or headscarf. In reality, these protests are the result of a much wider revolt against discrimination and prejudice.

Put simply, women are fed up with a regime that has sought to impose rigid rules on what is, and is not, permissible for women in a theocratic society whose guidelines are little changed since the overthrow of the Shah in 1979.

Women are serving multi-year jail sentences for simply refusing to wear the hijab.

Two other issues are also at play. One is the economic deprivation suffered by Iranians under the weight of persistent sanctions, rampant inflation and the continuing catastrophic decline in the value of the Iranian riyal.

The other issue is the fact Mahsa Amini, the 22-year-old whose death sparked the protests, was a Kurd.

The Kurds, who constitute about 10% of Iran’s 84 million population, feel themselves to be a persecuted minority. Tensions between the central government in Tehran and Kurds in their homeland on the boundaries of Iraq, Syria and Turkey are endemic.

Another important question is where all this leaves negotiations on the revival of the Joint Comprehensive Plan of Action (JCPOA). The JCPOA had been aimed at freezing Iran’s nuclear weapons ambitions. Former President Donald Trump recklessly abandoned the 2015 agreement in 2018.




Read more:
The Iran nuclear talks are resuming, but is there any trust left to strike a deal?


The Biden administration, along with its United Nations Security Council partners plus Germany, had been making progress in those negotiations, but those efforts are now stalled, if not frozen.

The spectacle of Iranian security forces violently putting down demonstrations in cities, towns and villages across Iran will make it virtually impossible in the short term for the US and its negotiating partners to negotiate a revised JCPOA with Tehran.

Russia’s use of Iranian-supplied “kamikaze” drones against Ukrainian targets will have further soured the atmosphere.

How will the US and its allies respond?

So will the US and its allies continue to tighten Iranian sanctions? And to what extent will the West seek to encourage and support protesters on the ground in Iran?

One initiative that is already underway is helping the protest movement to circumvent regime attempts to shut down electronic communications.

Elon Musk has announced he is activating his Starlink satellites to provide a vehicle for social media communications in Iran. Musk did the same thing in Ukraine to get around Russian attempts to shut down Ukrainian communications by taking out a European satellite system.

However, amid the spectacle of women and girls being shot and tear-gassed on Iranian streets, the moral dilemma for the outside world is this: how far the West is prepared to go in its backing for the protesters.

Since the Iranian protests began there have also been pro-government rallies in response.
Abedin Taherkenareh/EPA/AAP

It is one thing to express sympathy; it is another to take concrete steps to support the widespread agitation. This was also the conundrum during the Arab Spring of 2010 that brought down regimes in US-friendly countries like Egypt and Tunisia.

It should not be forgotten, in light of contemporary events, that Iran and Russia propped up Syria’s Assad regime during the Arab Spring, saving it from a near certain end.

In this latest period, the Middle East may not be on fire, as it was a decade or so ago, but it remains highly unstable. Iran’s neighbour, Iraq, is effectively without a government after months of violent agitation. The war in Yemen is threatening to spark up again, adding to uncertainties in the Gulf.




Read more:
3 ways these latest Iran demonstrations are different to past protests


In a geopolitical sense, Washington has to reckon with inroads Moscow has been making in relations with Gulf States, including, notably, Saudi Arabia.

The recent OPEC Plus decision to limit oil production constituted a slap to the US ahead of the mid-term elections in which fuel prices will be a potent issue.

In other words, Washington’s ability to influence events in the Middle East is eroding, partly as a consequence of a disastrous attempt to remake the region by going to war in Iraq in 2003.

The US’s ability to influence the Middle East is much weaker than before it went to war in Iraq in 2003.
Susan Walsh/AP/AAP

A volatile region

Among the consequences of that misjudgement is the empowerment of Iran in conjunction with a Shia majority in Iraq. This should have been foreseen.

So quite apart from the waves of protest in Iran, the region is a tinderbox with multiple unresolved conflicts.

In Afghanistan, on the fringes of the Middle East, women protesters have taken the lead in recent days from their Iranian sisters and have been protesting against conservative dress codes and limitations on access to education under the Taliban.

This returns us to the moral issue of the extent to which the outside world should support the protests. In this, the experience of the “green” rebellion of 2009 on Iran’s streets is relevant.

Then, the Obama administration, after initially giving encouragement to the demonstrations, pulled back on the grounds it did not wish to jeopardise negotiations on a nuclear deal with Iran or undermine the protests by attaching US support.

Officials involved in the administration, who are now back in the Biden White House, believe that approach was a mistake. However, that begs the question as to what practically the US and its allies can do to stop Iran’s assault on its own women and girls.

What if, as a consequence of Western encouragement to the demonstrators, many hundreds more die or are incarcerated? What is the end result, beyond indulging in the usual rhetorical exercises such as expressing “concern” and threatening to ramp up sanctions that hurt individual Iranians more than the regime itself?

The bottom line is that irrespective of what might be the desired outcome, Iran’s regime is unlikely to crumble. It might be shaken, it might entertain concerns that its own revolution that replaced the Shah is in danger of being replicated, but it would be naïve to believe that a rotting 43-year-old edifice would be anything but utterly ruthless in putting an end to the demonstrations.

This includes unrest in the oil industry, in which workers are expressing solidarity with the demonstrators. The oil worker protest will be concerning the regime, given the centrality of oil production to Iran’s economy.

However, a powerful women’s movement has been unleashed in Iran. Over time, this movement may well force a theocratic regime to loosen restrictions on women and their participation in the political life of the country. That is the hope, but as history has shown, a ruthless regime will stop at little to re-assert its control.

The Conversation

Tony Walker is a board member of The Conversation.

ref. Women-led protests in Iran gather momentum – but will they be enough to bring about change? – https://theconversation.com/women-led-protests-in-iran-gather-momentum-but-will-they-be-enough-to-bring-about-change-192165

I was an expert advisor on the documentary ‘How to Thrive’. Here’s what happened after this wellbeing experiment

Source: The Conversation (Au and NZ) – By Peggy Kern, Associate professor, Centre for Positive Psychology, The University of Melbourne

Priscilla Du Preez/Unsplash, CC BY-SA

The How to Thrive documentary, which screens in cinemas from today, follows seven people as they learn to not only survive, but thrive.

The documentary aligns with “positive psychology”, which aims to provide people with the skills and resources to proactively support their mental health and wellbeing.

I research positive psychology and was as an expert advisor for the documentary, assessing the participants’ progress over 18 months.

My analysis shows the evidence-based strategies in the documentary supported participants to thrive, leading most of them to feel and function well across multiple aspects of their lives.

There are lessons here for everyone. Here’s what we learned from the intensive film-making process that you can apply to better your life.




Read more:
Explainer: what is positive psychology and how can you use it for yourself?


The process

Filming began just before the start of the pandemic. Twelve people from diverse backgrounds – all with varying degrees of mental illness – took part. A two-day retreat introduced everyone to each other, and the journey ahead.

Each person had their own psychiatric supports as a requirement for being part of the program. There was also a clinical psychologist overseeing the process.

Then lockdown began.

Participants connected through Zoom, creating a sense of community and developing a sense of belonging. They were introduced to evidence-based strategies to improve their lives, and filmed their progress on their phones.

All participants learned about their character strengths (the positive parts of your personality that make you feel authentic and engaged), created a vision board of their best possible future self, practised self-compassion, and identified what went well in their life and why.

They also received individual coaching sessions, and were given activities specific to their needs.

Of the original 12 participants, seven were included in the final cut of the film, based on which stories allowed the producers to talk about a range of approaches and diversity of mental health conditions.

How to Thrive, due for release in cinemas October 13.

How I assessed their progress

I collected data documenting participants’ experiences, mental illness and wellbeing.

Over eight months, participants made major changes in their lives and saw the benefits. Benefits continuing over the subsequent ten months.

Let’s take a scale from -10 (to indicate high mental distress) to +10 (completely thriving).

On average, participants went from -3.2 (mild-to-moderate distress) to +5.4. Even a 2-point improvement would be statistically significant. But we saw a difference of more than 8 points, clearly showing participants were thriving, and demonstrating clinically significant improvements.

The greatest changes occurred from March to April 2020, during the documentary’s main intervention period. But improvements continued over the next 17 months.

How to Thrive poster
Participants said they were struggling less.
How to Thrive/IMDB

On average, participants felt more satisfied with their lives, more hopeful, more engaged, and more connected. Participants improved their physical health, and felt less lonely and distressed.

Participants felt like they were struggling less. They felt more supported by others and gave more support to others. They increased their skills, resources, and motivation to live well.

The results support studies suggesting happiness does not just happen – it’s a skill that can be learned and developed, with the right aims and supports in place.




Read more:
How to avoid ‘toxic positivity’ and take the less direct route to happiness


What else could be going on?

While seven participants were included in the final cut, all the original 12 took part in the assessments across the first 12 months. Almost all demonstrating significant increases in their mental health and wellbeing across the intervention period and beyond.

One participant, who did not engage in many of the intervention activities and remained distant from the group, did not see these improvements.

It’s possible the benefits arose from the psychiatric supports participants had in place as part of the documentary. However, each
participant had years of experience with psychologists, psychiatrists, and other mental health supports, yet continued to deeply struggle.

This suggests the intervention provided added benefits to usual mental health care.

Studies suggest that positive psychology interventions can increase wellbeing and reduce the symptoms of depression.

However, we don’t know how positive psychology interventions alone compare with usual mental health care. We also don’t have evidence for adding positive psychology to usual mental care.

Positive psychology interventions have mostly been used with people without moderate-to-severe mental illness. Indeed, one of the extraordinary parts of this experiment was adding positive psychology to typical care for people with moderate-to-severe mental illness.

What can we learn?

The documentary suggests several key ways to support mental health and wellbeing.

1. Find your tribe

Throughout the documentary, participants developed a community. Humans have a natural need for belonging. In contrast, loneliness relates to mental and physical illness, and even early death. Find people that you can belong with and connect at a deep level, beyond superficial “friends”.

2. Engage in meaningful activities

Studies suggest engagement in life is an important marker of healthy ageing. This means not simply gliding through life, but sucking the marrow out of life. It involves finding and committing to activities that fill you up and give you a sense of life, rather than those that drain the life from you.

3. Be compassionate

Be compassionate towards yourself and others. We are often our own worst critics. We are doing the best we can. Be kind to yourself, and extend that kindness to others.

4. Be optimistic

Be optimistic and hopeful for the future. Things won’t always work out, but if we are biased towards seeing the possibility of what could be, the results might surprise us.

5. Nurture yourself

Nurture your physical, mental, social and spiritual wellbeing. Eat and rest well, engage in moderate physical activity, and actively engage in activities that make you feel and function well.

But be careful

Positive psychology interventions are far from a panacea. As part of the documentary, they only worked for those who actively took part in the interventions and connected well with others.

Each participant was dealing with one or more mental illnesses. So positive psychology was not a replacement for conventional psychiatric support. They went hand-in-hand.

While the documentary presents a hopeful story of recovery, if you are struggling with mental illness, it’s important to connect with additional forms of support, including your GP, psychologist or psychiatrist.


If this article has raised issues for you, or if you’re concerned about someone you know, call Lifeline on 13 11 14.

The Conversation

Peggy Kern has served as a voluntary content advisor for the How to Thrive project and reports here on her professional experience with the documentary.

ref. I was an expert advisor on the documentary ‘How to Thrive’. Here’s what happened after this wellbeing experiment – https://theconversation.com/i-was-an-expert-advisor-on-the-documentary-how-to-thrive-heres-what-happened-after-this-wellbeing-experiment-191500

These stunning satellite images look like abstract art – and they reveal much about our planet

Source: The Conversation (Au and NZ) – By Emily Finch, Research Affiliate, Monash University

This is an enhanced satellite image of Western Australia’s Great Sandy Desert. Yellow sand dunes cover the upper right, red splotches indicate burned areas, and other colours show different types of surface geology.
USGS/Unsplash, CC BY

Environmental scientists see flora, fauna and phenomena the rest of us rarely do. In this series, we’ve invited them to share their unique photos from the field.


There’s something to be said for a job that pays you to stroll over the Scottish Highlands, scoot around a Greek Island, or go on an expedition to Antarctica – all in the name of geoscience, the study of the Earth.

But during COVID travel restrictions, many geologists had to mine the collection of samples and data they already had. Other geologists used satellite and other images to make geological interpretations.

This field of geology is called remote sensing, which is the process of using, for instance, satellites or aeroplanes to observe the physical features of an area at a distance. It’s often easier to see how geology shapes our landscapes by taking this birds-eye view.

In terrific news for remote sensing geologists, armchair geology enthusiasts and lovers of stunning landscapes, the United States Geological Survey (USGS) has a vast collection of satellite images of the Earth’s surface, capturing breathtaking geological features from space.

Remote sensing geologists use many techniques which make features of interest more distinct. This enhances or alters colours, which you can see in a few of my picks of USGS’s eight most fascinating images. Here’s what they reveal about the planet.




Read more:
5 rocks any great Australian rock collection should have, and where to find them


Volcanoes from space

Volcanoes are usually pretty distinctive when you see them from the ground, whether it’s the iconic Mount Fuji, the lava fields of Iceland, or the hundreds of volcanoes that pockmark the fields of western Victoria in Australia.

From above, they can look a little different. In the first image below of Mount Elgon on the border of Uganda and Kenya, you can spot the “caldera” – a bowl-shaped depression in the centre of the volcano where the rock has collapsed after the magma chamber empties.

In the second image of New Zealand’s Mount Taranaki, you can spot the crater, which is also a depression, but forms when the volcano explodes and rocks are ejected.

Mount Elgon, Uganda and Kenya.
United States Geological Survey/Unsplash
Volcano crater from above surrounded by a dark green circle of forest
Mount Taranaki in Egmont National Park, New Zealand.
United States Geological Survey/Unsplash

The products of volcanoes may also be obvious in satellite images. You can see the lava flow from the Haruj volcano in Libya in the third image below. It is a black stain of basalt on the surrounding white and yellow sand, to envy even the finest Rorschach inkblots.

This field of lava is about 185 kilometres wide, a huge distance that’s possible because the chemical composition of the lava made it runny and able to flow a long distance from the eruption site.

A black splatter of lava in surrounding sandy desert landscape
The Haruj Volcanic Field, Libya.
United States Geological Survey/Unsplash

Some magma-related features have stumped geologists for years. Only by combining remote sensing with observations on the ground have they been able to solve these geological puzzles. The Richat Structure in Mauritania’s Maur Adrar Desert, shown below, is one such feature.

It looks like a meteorite impact crater or, perhaps, a bullseye for intergalactic visitors. But in recent years, researchers determined – after much debate – that it formed when a series of magmas from deep below the surface intruded into the existing sediments.

Grey concentric rings of rock surrounded by green landscape from above
The Richat Structure, Mauritania.
United States Geological Survey/Unsplash

Some of these magmas formed concentric circles, known as ring dikes, which is the main feature we see in satellite imagery. These ring dike magmas never reached the surface and are only exposed now because the overlying rocks eroded away over time.

But other magmas in the series did make it to the surface to erupt as lava. You can see the small volcano formed by these surface eruptions on the USGS image where it appears as a white-grey smudge interrupting the southwestern part of the innermost ring dike.




Read more:
Photos from the field: the stunning crystals revealing deep secrets about Australian volcanoes


When rocks collide

The landscapes of Iran’s Zagros Mountains and China’s Keping Shan thrust range have two major things in common.

First, they both look spectacular from above. Second, they were both formed at the bottom of oceans and were then uplifted and deformed by geological forces to form the ridges and valleys which dominate these two regions today.

View from above of domes of rock between valleys
Zagros Mountains, Iran.
United States Geological Survey/Unsplash
A landscape from above showing multi-coloured layers of rock that have been folded and broken apart
Keping Shan thrust belt, China.
United States Geological Survey/Unsplash

Both mountain belts were created when land masses collided, and the pressure from these collisions caused the rocks to fold over themselves. In some places, the rocks broke apart completely.

These breaks, known as faults, brought up deeper, older rocks to sit on top of younger rocks. These faults form the layered ridges seen in the satellite image of Keping Shan.

Unlike Keping Shan, the ridges in the Zagros Mountains were formed when softer rocks, such as silt and mudstone, were eroded away over time. This erosion formed valleys beside the more resistant rocks of limestone and dolomite, which comprise the arch-shaped folded domes.

Unravelling rivers

Rivers make huge changes to our landscapes. Over many years they can find and exploit weaknesses in rocks to carve their way through any terrain. Rivers look and behave differently depending on factors such as flow rate, how much sediment they carry, and the gradient of the slope they’re on.

Rivers can consist of one narrow and winding stream (called a meandering river) such as the Beni River in Bolivia, or a wide channel made up of many branches braided together between bars of sediment (called a braided river), such as the portion of Brazil’s Rio Negro in the last image below.

A blue sinuous river cuts through bright green forest
Beni River, Bolivia.
United States Geological Survey/Unsplash, CC BY
View from above of the blue Rio Negro (black river) with a mosaic of rivers surrounded by green plains.
Rio Negro, Brazil.
United States Geological Survey/Unsplash, CC BY

Looking at the meandering Beni River from above, you can see how the twists and turns of the river have evolved over time. The u-shaped lakes scattered along the edges of the river are called oxbow lakes.

These oxbow lakes are the former channel of the river which have since been cut off when the river eroded a new, more direct channel to follow. In Australia, oxbow lakes are also known as billabongs.

Unlike the slowly meandering Beni River, the wide channel of the Rio Negro is created by fast flows and the deposition of coarse sediment. These characteristics form the mosaic of small islands between the branching flow of water. The islands become submerged during Brazil’s wet season when the volume and flow of the water is higher.

Armed with this new knowledge, book a window seat next time you fly and see what geological wonders you can spy from above.




Read more:
The dingo fence from space: satellite images show how these top predators alter the desert


The Conversation

Emily Finch has previously received funding from an Australian Postgraduate Award and a Society of Economic Geologists Graduate Student Fellowship.

ref. These stunning satellite images look like abstract art – and they reveal much about our planet – https://theconversation.com/these-stunning-satellite-images-look-like-abstract-art-and-they-reveal-much-about-our-planet-171950

If Australia wants to improve school outcomes, we need to define what ‘equity’ really means

Source: The Conversation (Au and NZ) – By Pasi Sahlberg, Professor of Education, Southern Cross University

Joel Carrett/AAP

Last week, the Productivity Commission released a major report on how to improve Australia’s school and university sectors. “Education is ripe for disruption”, deputy chair Alex Robson said.

The commission suggests longer schooldays, online classes taught by qualified teachers, and streaming students into ability groups to improve Australia’s educational performance.

But while these ideas may work well for some students, they won’t necessarily work for all.

If Australia is serious about improving its education system, we need to look at improving the whole system, for all students. This means we need a clear definition of what equity means for schools.

Why we need to focus on equity

About three years ago, all state and territory governments made a commitment to promote “excellence” and “equity” in Australian education in the Alice Springs (Mparntwe) Declaration. This sets out a “vision for a world class education system” and is supposed to guide education policy-making and related education reforms in states, territories, and the whole country.

The “excellence” component is easy to understand. It normally refers to the quality of measured student learning outcomes in school. But “equity” remains poorly defined and inadequately included and monitored in current education policies.

Educational equity is often described using terms such as fairness, inclusion, social justice, non-discrimination, and equal opportunity. These are worthy principles but do not provide a guide for what equity means in practice, how it should be monitored, and how progress should be measured.

Without a commonly shared definition of educational equity it is impossible to make progress. It allows governments to scapegoat schools for widening achievement gaps and growing learning inequalities, while nobody else is held accountable for improving equity.

The next national school reform agreement

Australian states and territories are about to begin negotiations for the next national school reform agreement, which sets out how to lift student outcomes and improve education systems performance from 2024.

As part of this process, the Productivity Commission’s review of the existing agreement was published in September.

This interim report (the final report is due in December) correctly states equity is one of four major policy challenges facing Australia’s school system. But when trying to explain what equity means, it does not clearly address what equity targets would look like and how they would be monitored.

The interim report claims equity is already defined in the 2008 Melbourne Declaration on Education and its successor, the Mparntwe Declaration. But there is no clear, useful definition written in any of these declarations. Instead, the report says equity “can be thought of as recognising that some students may have different educational needs and desired outcomes”. These are hardly insightful or practical guides to education policy, let alone school improvement.

Without a definition, the next agreement will not be able to make Australian school education more equitable.

How should we define equity

Our submission to the Productivity Commissions’s school agreement inquiry proposes a clear definition of educational equity.

We argue equity has two dimensions: individual and social. That is, equity should involve a minimum level educational attainment for all students, and similar education outcomes for different social groups.




Read more:
The Productivity Commission says Australian schools ‘fall short’ on quality and equity. What happens now?


An individual dimension of equity in education means that all children receive an education that enables them to fully participate in adult society in a way of their choosing.

Today in Australia and other OECD countries, this requires that all children should complete Year 12 or its equivalent amount of education (for example TAFE). We are far from that goal. The Year 7/8 to Year 12 full-time apparent retention rates in 2021 were 83% for all students, and 59% for Aboriginal and Torres Strait Islander students. The existing schools agreement says 96% of students should complete year 12 by 2031.

A social dimension of equity in education means students from different social groups achieve similar average outcomes, and a similar distribution range of these outcomes.




Read more:
What does equity in schools look like? And how is it tied to growing teacher shortages?


The benchmark for educational equity is the achievement and attainment of the most successful social group of students. The OECD’s PISA (international student assessment) results, our own NAPLAN data, and Year 12 examination results show this benchmark is students from high socio-economic status (SES) families.

For example, the PISA 2018 results showed 15-year-old Australian students from the highest SES quartile were nearly three years ahead of students from the lowest SES quartile in reading, and four years ahead of Aboriginal and Torres Strait Islander students. An analysis published last weekend by former principal and author Chris Bonnor found 60% of the highest achieving students in Year 12 in NSW’s HSC exams are concentrated in the most advantaged schools.

Equitable education would set up the expectation Indigenous, socio-economically disadvantaged, rural and remote students achieve similar education outcomes to affluent students. There is no reason to consider, for example, that some groups of students are innately less intelligent than their peers from well-off privileged families.

Why we need equity

Equity in education is fundamental to an egalitarian, democratic nation.

Inability to define equity in education clearly will ensure we will continue to make little or no progress in keeping the promise of equitable education for every child.

So, defining equity well is the first step towards achieving it. The existing inequities in education are also a measure of the potential to increase productivity and economic prosperity. Investing in reducing inequity promises a way to overcome the current shortage of workforce skills and prepare the nation for uncertainty.

The Conversation

Pasi Sahlberg does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.

ref. If Australia wants to improve school outcomes, we need to define what ‘equity’ really means – https://theconversation.com/if-australia-wants-to-improve-school-outcomes-we-need-to-define-what-equity-really-means-192095

We’ve been collecting souvenirs for thousands of years. They are valuable cultural artefacts – but what does their future hold?

Source: The Conversation (Au and NZ) – By Amy Clarke, Senior Lecturer in History specialising in architectural heritage and material culture, University of the Sunshine Coast

Cup and saucer commemorating the opening of Federal Parliament 1927.
National Museum of Australia, CC BY-NC-SA

Souvenirs are an almost unavoidable feature of holidays. Tourist thoroughfares are lined with shops and stalls selling postcards, clothing and knick-knacks of all kinds.

Shopping while on vacation – including for souvenirs – is a multi-million dollar pastime. Tourists spend around one-third of their travel budget on retail purchases.

Souvenirs use recognisable images to remind us of the location they represent. The particular images promoted can also reveal a great deal about the cultures that produce and sell them, as well as the tourists who buy them.

But questions have begun to be raised about the viability of souvenirs. They are often made from cheap, unsustainable materials. It can be difficult to find items made by locals. And, perhaps most acutely, younger generations of travellers seem to be replacing physical souvenirs with digital ones shared on social media.

Souvenirs of Tasmania, photographed around 1892.
Libraries Tasmania

A long history

When we think of souvenirs we think of teaspoons, keychains, t-shirts and hats, but these are only the most recent types of items brought home by travellers.

The word “souvenir” is French in origin, and loosely translates as “recollection” or “memory”. It entered English around the end of the 18th century, and for the past few centuries the word has been used to refer to objects that remind us of a certain place or time.

The Staffordshire Moorlands Pan, c 2nd century, was a souvenir for the Roman site of Hadrian’s Wall.
© The Trustees of the British Museum, CC BY-NC-SA

But people have been collecting items far longer than this. The ancient Egyptians, Greeks and Romans brought home rare artefacts and products from their expeditions in foreign lands.

Following the crucifixion of Jesus, it was common for pilgrims to collect dirt and pebbles from Holy Land sites, believing these physical remnants held miracle-giving powers.

The Virgin and Child, the Virgin with crown and sceptre, standing on a crescent moon with a decorative beaded border.
This pilgrim badge was made in France in the late 15th/early 16th century.
© The Trustees of the British Museum, CC BY-NC-ND

By the medieval period, Christian pilgrimages throughout Europe and the Middle East sparked an early souvenir industry. Pilgrims could purchase small bottles filled with sacred water or oil, or metal badges commonly decorated with the images of local saints.

As recently as the 18th century, well-known tourist attractions were falling victim to souvenir-seeking. Visitors would chip away pieces of important buildings and objects, hoping to capture a little bit of the “magic” for themselves.

While visiting Stratford-upon-Avon in 1786, American presidents John Adams and Thomas Jefferson allegedly carved off pieces of a wooden chair believed to have belonged to William Shakespeare.

Industrialisation and the rapid development of mass manufacturing drastically altered the souvenir industry. By the late 19th century, tourists were able to purchase teaspoons, plates, postcards and even snow globes commemorating locations and historic events.

A souvenir pocket watch from the Melbourne International Exhibition, 1880.
Copyright Museums Victoria, CC BY

Travel for leisure remained a luxury until after the second world war. In the second half of the 20th century, long-haul flights and increasing car ownership made tourism a pastime of the masses.

With this change came a hunger for cheap, easily portable objects that could be gifted to family and friends back home, or placed on mantelpieces and sideboards as reminders of journeys taken and spectacles witnessed.




Read more:
From caravans to markets, the hajj pilgrimage has always included a commercial component


Uncertain futures

Despite being a common aspect of travelling for more than two millennia, souvenirs are facing an uncertain future in the 21st century.

As awareness grows of the potential environmental harm caused by cheap, mass-produced and non-biodegradable items, travellers are starting to turn towards more sustainable options.

Following numerous reports of damage to reefs, beaches and other natural environments, many governments have begun imposing harsh penalties on tourists caught in possession of coral, shells and botanical samples taken as souvenirs.

Increased attention is also being paid to the authenticity of handcrafted items. A recent study found two-thirds of “Aboriginal” souvenirs are not made by Aboriginal and Torres Strait Islander people. This means First Nations Australians are not gaining the full benefit of tourist interest in such objects.

A tacky souvenir shop.
Two-thirds of ‘Aboriginal’ souvenirs aren’t made by First Nations people.
Shutterstock

Then there is perhaps the greatest challenge to the future of souvenirs: social media.

Before the digital era, people purchased souvenirs to remind themselves of where they had been and what they had seen, and to serve as evidence of these travels to those who stayed home.

These desires can now be satisfied instantly with a post to Instagram or TikTok, and perhaps more effectively, too. More people are likely to see your posts about holidaying in Greece than will have the opportunity to examine the miniature model of the Acropolis gathering dust on your bookshelf.

While posts, reels, stories and videos shared online may replace the purchasing of physical souvenirs for many people, it seems unlikely knick-knacks and mementos will disappear altogether.

The roaring trade in souvenirs commemorating Queen Elizabeth II shows people still feel the need to mark momentous occasions by purchasing t-shirts, mugs, postcards and other memorabilia.

While such items may have a practical use in the kitchen or as everyday clothing, there are many who value these objects as modern day relics, and who treat them as priceless artefacts to be seen but not touched.




Read more:
Royal family: why even a Charles and Diana divorce mug is important for the monarchy


The Conversation

Amy Clarke does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.

ref. We’ve been collecting souvenirs for thousands of years. They are valuable cultural artefacts – but what does their future hold? – https://theconversation.com/weve-been-collecting-souvenirs-for-thousands-of-years-they-are-valuable-cultural-artefacts-but-what-does-their-future-hold-189449

Mind the gap: gender differences in time use appear to be narrowing, but slowly

Source: The Conversation (Au and NZ) – By John Hawkins, Senior Lecturer, Canberra School of Politics, Economics and Society, University of Canberra

Shutterstock

The Australian Bureau of Statistics has released its first time-use survey in 15 years. The last time it collected such data, in 2006, Apple was yet to release the iPhone and Facebook was a start-up.

So much has changed, though the differences in time use between men and women have not changed as much as many might like.

The new survey suggests we’re spending an average of 4 hours 23 minutes a day watching video, listening to audio or some other activity involving a computer or handheld device.

The average full-time worker spent 8 hours 44 minutes a day on employment-related activities. But we’re getting pretty much the same amount of sleep – about 8½ hours on average for both men and women.

The survey suggests a slight narrowing in gender differences – but with domestic and caring responsibilities still principally undertaken by women.

Caution, however, is needed in interpreting these new results. The data was collected from 2,000 households between November 2020 and July 2021. So the times reported reflect the COVID-19 pandemic, with closed borders, restrictions and lockdowns. These were not ‘normal’ times.

Comparisons with the past data (from 2006, 1997, 1992 and the 1987 pilot study) are further complicated by the bureau warning the new figures “are not fully comparable with previous collections due to changes in methodology”.

With this in mind, let’s take a look.

How we use our time

Our first graph shows how men and women, on average, spend their days.

Necessary activities are things like sleeping, eating and personal care.
Contracted activities are things such as paid work and education. Committed activities cover unpaid domestic chores, child care, adult care and voluntary work. Free time means exactly that.


Made with Flourish

These times add up to over 24 hours. This is because many people spend part of their day doing two things at once. For example, while at work or driving or having breakfast (what the bureau terms a “primary” activity), they may be listening to the radio (a “secondary” activity).

Nonetheless they provide a useful snapshot – with men spending more time on paid work, and women more time on unpaid work.

When we’re working

Most of us who work do so during standard office or trading hours. But about a tenth of all workers were working between 8 pm and 10 pm at the time of the survey – either because they were shift workers or due to (paid or unpaid) overtime.


Made with Flourish

Time on domestic chores

On average women spent 3 hours 22 minutes a day on domestic responsibilities, compared with 2 hours 19 minutes for men. (Child-care responsibilities were on top of this – an average of 1 hour 26 minutes for women, 40 minutes for men.)


Made with Flourish

The time-use survey also reports these activities by participation rate and by average time spent by those who undertake such activities.

The percentage of men reporting doing any domestic activities was 84%, compared with 94% of women. Participation differences were particularly pronounced in housework (72% of women compared with 44% of men) and cooking (77% of women compared with 56% of men).

Among those who reported doing these activities, women spent an average 3 hours 36 minutes compared with an average 2 hours 46 minutes for men.

How we use our leisure time

In its 2006 survey the ABS reported five main categories for how people spent their leisure time: sport and other outdoor activities; games, hobbies, arts and crafts; talking, writing or reading correspondence; using audiovisual media; and “other” activities.

This survey has updated procedures to ensure greater clarity around our burgeoning consumption of various types of media – recording times for listening to music and podcasts; games and puzzles; video games; and general internet and device use.


Made with Flourish

Feeling under pressure

Perhaps not surprisingly, more women than men reported feeling “rushed or pressed for time”. These stresses were particularly prevalent among parents with children at home.


Made with Flourish

Are gender differences narrowing?

While comparison with past surveys is complicated for the reasons mentioned, gender differences do appear to have narrowed, with men doing a little more housework.


Made with Flourish

This is consistent with international studies suggesting “some signs of gender convergence, with a widespread decrease in women’s housework … and increases in men’s housework and childcare”.

However, with comparisons with earlier years being muddied by the pandemic and changes to coding procedures, we will have to wait for the next time-use survey for a clearer picture.

Hopefully it won’t be 15 years.

The Conversation

Michael Walsh worked at the Australian Bureau of Statistics (ABS) between 2011 and 2015. Michael has no ongoing employment or financial links with the ABS.

John Hawkins does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.

ref. Mind the gap: gender differences in time use appear to be narrowing, but slowly – https://theconversation.com/mind-the-gap-gender-differences-in-time-use-appear-to-be-narrowing-but-slowly-191678

King Charles III will be coronated in May. The ritual has ancient origins – here’s what we can expect

Source: The Conversation (Au and NZ) – By Joel Hodge, Senior lecturer, Australian Catholic University

King Charles III’s coronation will take place at Westminster Abbey on May 6 2023. But what is a coronation, and what can we expect?

A coronation is a ritual act bestowing a crown (or similar decorative head-piece) symbolising royal or imperial power.

It is usually associated with other important political and religious acts, such as oaths, anointing, enthronement, homage, parades, gift-giving or presentation to the people.

These acts will be on display in the coronation of Charles III.

Coronations are not necessarily legally required for the exercise of a monarchical office – Charles is already king. Instead, coronations are fundamentally symbolic and ritual.

They affirm a social and political structure within the larger political theology of a polity.

In Europe, they have played a pivotal function in formalising the acceptance by clergy, nobles and general populace of a monarch’s accession to office.




Read more:
What to expect from the reign of King Charles III


A short history

Crowns and coronations have ancient origins and were popularised in Europe during the early Middle Ages.

In the Roman empire, Constantine the Great began the practice of wearing a diadem (an ornamental headband), and the emperor Julian was raised up by soldiers on a shield.

Christian coronation rites developed later in the Byzantine empire, and the Carolingian Franks in western Europe added the anointing.

This 13th century artwork shows a Byzantine coronation.
Wikimedia Commons

Coronation services were usually performed by a political leader or member of the clergy, such as a prominent local bishop or even the Pope.

Coronations underwent standardisation, development and change across the Middle Ages and gradually declined in the modern period.

The British crown is the only surviving European monarchy that retains a coronation, though there are Asian and African countries that still practice it.

Coronation of Emperor Napoleon I, as painted by Jacques-Louis David and Georges Rouget.
Wikimedia Commons

Other surviving monarchies have enthronement (such as Japan and Luxembourg) or inauguration (such as Spain and Sweden) ceremonies which are secular or religious in form.

Coronations like those still held in England are associated with a biblical theology of kingship. The monarch is given a divine and priestly commissioning like Israelite kings Saul, David and Solomon in the Old Testament.

Over time, European coronations shifted from primarily emphasising divine commissioning to responsibilities before the law and to the people. The British coronation retains all these elements.

British coronations

The coronation of the British monarch is a religious event. It presents the political-theological vision of the British state as a union of nations and peoples under God.

This union is celebrated in the coronation ritual, which occurs in the context of a Eucharistic liturgy.

Eucharist is about communion. In this case, God bringing together the monarch and people in commemoration of Jesus’ last supper, self-giving death and salvific resurrection.

The liturgy comprises six key elements, defined by the Anglican rite as “the recognition, the oath, the anointing, the investiture (which includes the crowning), the enthronement and the homage.”

Special instruments are used to symbolise the monarch’s sacred office.

Saint Edward’s crown and chair (symbolising the monarch’s significance and connection to British and Christian tradition), the sceptre (an ancient biblical symbol of rule), the orb with cross (symbolising the whole world under Christ) and a ring (symbolising the monarch’s “marriage” to his or her people, in a way like Christ is said by St Paul to be married to the Church).

While all these symbols are important, the anointing of the monarch with holy oil (chrism) is perhaps the most significant moment of the liturgy. This was the one moment not televised during Elizabeth II’s coronation service.

Like the Eucharist, anointing is an ancient sacramental practice of Christians used in baptism and confirmation. The anointing by the Archbishop fundamentally marks the body of the monarch as a special sign and for a special purpose.

Under the traditions of the coronation, the anointing is said to bestow God’s grace on the monarch to become a living sign of God’s mercy, justice and love in the world.

In this, the monarch is not divine or absolute in power, but rather relies on the sovereignty and power of God. As such, God enables the monarch to exercise his or her office in selfless service, duty and love in the manner of Jesus Christ and in relationship with him.

Here, the monarch becomes an anointed symbolon (sacrament) who expresses the meaning of life, community and faith in his or her person as a special mediator of Christ.

This symbolic power is deep and primal, as was shown in the reverence for Queen Elizabeth II’s body at her death.

The coronation ritual highlights the Christian-state nexus that remains at the heart of the British polity.

An established church seems anachronistic in a secular age and arguably compromises both the church and politics.

Nevertheless, despite declining in numbers, Anglicanism provides a common, transcendent frame-of-reference for fundamental values and virtues, in an age struggling with individualism, division and fragmentation.

Charles III’s coronation

Given the importance of tradition for British society, the establishment position of the Church of England and Charles’ own personal faith, the rite of coronation will remain broadly the same.

As with Elizabeth, the ritual will be Anglican in format, though likely streamlined from what we saw in 1953.

We can also expect it will include ecumenical (reflecting other Christian churches) and inter-religious elements, to which Charles and recent British monarchs have become more sensitive.

In essence, the coronation will present the vision of a British monarchy representing loving service, loyalty and duty before God, tradition and a diverse people and nation.




Read more:
16 visits over 57 years: reflecting on Queen Elizabeth II’s long relationship with Australia


The Conversation

Joel Hodge does not work for, consult, own shares in or receive funding from any company or organization that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.

ref. King Charles III will be coronated in May. The ritual has ancient origins – here’s what we can expect – https://theconversation.com/king-charles-iii-will-be-coronated-in-may-the-ritual-has-ancient-origins-heres-what-we-can-expect-191262

Federal Labor’s honeymoon continues in Resolve poll; can the Liberals regain office without those ‘lefties’?

Source: The Conversation (Au and NZ) – By Adrian Beaumont, Election Analyst (Psephologist) at The Conversation; and Honorary Associate, School of Mathematics and Statistics, The University of Melbourne

Mick Tsikas/AAP

A federal Resolve poll for Nine newspapers, conducted October 5-9 from a sample of 1,604, gave Labor 39% of the primary vote (steady since September), the Coalition 30% (down two), the Greens 12% (up two), One Nation 5% (down one), the UAP 3% (up one), independents 9% (up one) and others 2% (down one).

Resolve does not give a two party estimate until close to elections, but using 2022 election preference flows gives Labor a 59-41 lead, a two-point gain for Labor since the September poll.

On Prime Minister Anthony Albanese, 60% thought he was doing a good job and 24% a poor job, for a net approval of +36, unchanged since September. Opposition Leader Peter Dutton’s net approval was -10, up two points. Albanese led Dutton by 53-18 as preferred PM (53-19 in September).

Labor led the Liberals by 36-30 on economic management (33-30 in September). On keeping the cost of living low, Labor led by 30-20 (31-23 previously).

The polling now is not predictive of the next election that is due by 2025, but for the moment Labor’s honeymoon is continuing.

Tax and spending questions

Respondents were told that the federal budget was in deficit, and that this is needed to maintain current levels of spending, but means the national debt is increasing. 37% thought we should reduce spending to end deficits earlier, 14% increase taxes and 28% live with the debt and deficit levels.

Asked to select the top priority for spending reduction, 33% chose defence, 14% the NDIS, 11% the health system and 4% aged care.

By 38-20, voters supported “delivering on the stage 3 tax cuts in 2024, which would mean everyone earning between $45,000 and $120,000 per year would pay a single 30% income tax rate”. This does not mention high-income earners would benefit most, and so is a skewed question.

By 34-13, voters supported repealing stage three if the government were to increase tax revenue. But increasing the corporate tax rate (61-10 support) and an increased tax on resource companies’ profits (56-9 support) were far more popular.

I previously covered polling of both the Indigenous Voice to parliament and the republic in the last Resolve poll. The Voice led by 64-36, while the republic trailed by 54-46.

Essential poll: Australia ‘not doing enought’ on climate change drops

In last week’s Essential poll, conducted in the days before October 4 from a sample of 1,050, 43% thought Australia was not doing enough to address climate change (down four since May), 32% thought we were doing enough (steady), and 13% doing too much (up two). The Coalition was still in government at the May poll.

By 63-21, respondents said they had not been personally affected by the recent Optus data breach. 53% said they were very concerned about scammers being able to steal their identities to access their bank accounts.

By 51-29, respondents supported stronger restrictions on the amount of personal infromation companies can collect, and by 46-27 they supported more restrictions on governments collecting personal information.

Respondents were pessimistic about the future of humanity, with more undecided at longer time intervals. Asked whether life would be better or worse for humanity in ten years, worse led by 42-33. At 100 years, worse led by 39-28. At 1,000 years, worse led by 36-22. At 10,000 years, worse led by 35-20.

Australia Institute poll: support for axing stage three tax cuts

Dynata conducted a survey for the left-wing Australia Institute in early September from a sample of 1,409. By 41-22, respondents supported Labor repealing the stage three income tax cuts. 46% said high-income earners would benefit most from these cuts, 18% middle-income earners and just 8% low-income earners.

Respondents were read a brief statement about the stage three tax cuts, and asked which was more important: keeping election promises regardless of changes in economic circumstances, or adapting economic policy to suit changing circumstances even if that means breaking an election promise. By 61-27, respondents supported the latter proposition.

A new poll for The Australia Institute, conducted October 4-7 from a sample of 1,003, had support for scrapping the stage three tax cuts up seven from September to 48%, with opposition unchanged at 22%.

Morgan poll: 55-45 to Labor

In last week’s Morgan poll, Labor led by 55-45 from polling conducted September 26 to October 2. This was a 0.5-point gain for Labor since the previous week, and Labor’s best result in this poll since the election.

Can the Liberals regain government without those ‘lefties’?

Federal Liberal vice-president Teena McQueen recently told the Australian Conservative Political Action Conference that: “The good thing about the last federal election is a lot of those lefties are gone. We should rejoice in that.”




À lire aussi :
View from The Hill: Without those ‘lefties’ the Liberals can’t regain government


At the May federal election, the seats held by more moderate Liberals in inner metro regions were lost to teal independents. It will be difficult for the Coalition to regain these seats as independents, once established in a seat, are usually re-elected easily.

However, as I said in my article on the final results of the election, the Coalition’s best chance to regain government in 2025 is if economic conditions are lousy, and they can win outer metro seats from Labor.

The next election probably depends on the outer metro, not the inner metro. The Coalition can do without its inner city moderates if it wins the rest of Australia by a large enough margin.

There may be a long-term electoral problem for the Coalition: Australia’s population is far more concentrated in cities than either the United States or the United Kingdom. I argued before the election that this urban concentration helps Labor, and the election results validated this argument.




À lire aussi :
Will a continuing education divide eventually favour Labor electorally due to our big cities?


Polls understated Bolsonaro at Brazilian election

I covered the October 2 first round of the Brazilian presidential election for The Poll Bludger. The leftist Luiz Inácio Lula da Silva (called “Lula”), who was president from 2003 to 2010, led the far-right inucmbent Jair Bolsonaro by a 48.4-43.2 margin. But as nobody won over 50%, it goes to an October 30 runoff between Lula and Bolsonaro. Pre-election polls understated Bolsonaro’s support.

I wrote about the November 8 US midterm elections on September 30, at which Democratic gains have recently stalled. Meanwhile, UK Labour has seized a huge poll lead after a “horror” budget was delivered by the Conservatives on September 23.




À lire aussi :
US Democrats’ gains stall six weeks before midterm elections; UK Labour seizes huge lead after budget


Dire polling has continued for the Conservatives: in eight UK national polls taken since October 5, Labour has led by 21 to 32 points.

The Conversation

Adrian Beaumont ne travaille pas, ne conseille pas, ne possède pas de parts, ne reçoit pas de fonds d’une organisation qui pourrait tirer profit de cet article, et n’a déclaré aucune autre affiliation que son organisme de recherche.

ref. Federal Labor’s honeymoon continues in Resolve poll; can the Liberals regain office without those ‘lefties’? – https://theconversation.com/federal-labors-honeymoon-continues-in-resolve-poll-can-the-liberals-regain-office-without-those-lefties-191679

DNA is often used in solving crimes. But how does DNA profiling actually work?

Source: The Conversation (Au and NZ) – By Adrian Linacre, Professor of Forensic Genetics, Flinders University

thinkhubstudio/Shutterstock

DNA profiling is frequently in the news. Public interest is sparked when DNA is used to identify a suspect or human remains, or resolves a cold case that seems all but forgotten.

Very occasionally, it is in the media when the process doesn’t work as it should.

So what is DNA profiling and how does it work – and why does it sometimes not work?




Read more:
Australia has 2,000 missing persons and 500 unidentified human remains – a dedicated lab could find matches


A short history of DNA profiling

DNA profiling, as it has been known since 1994, has been used in the criminal justice system since the late 1980s, and was originally termed “DNA fingerprinting”.

The DNA in every human is very similar – up to 99.9% identical, in fact. But strangely, about 98% of the DNA in our cells is not gene-related (i.e. has no known function).

This non-coding DNA is largely comprised of sequences of the four bases that make up the DNA in every cell.

A simple chart showing the very basics of the structure of DNA
The four DNA bases are guanine, cytosine, thymine and adenine, forming G-C and T-A pairs.
jaoad maha/Shutterstock

But for reasons unknown, some sections of the sequence are repeated: an example is TCTATCTATCTATCTATCTA where the sequence TCTA is repeated five times. While the number of times this DNA sequence is repeated is constant within a person, it can vary between people. One person might have 5 repeats but another 6, or 7 or 8.

There are a large number of variants and all humans fall into one of them. The detection of these repeats is the bedrock of modern DNA profiling. A DNA profile is a list of numbers, based on the repeated sequences we all have.

The use of these short repeat sequences (the technical term is “short tandem repeat” or STR) started in 1994 when the UK Forensic Science Service identified four of these regions. The chance that two people taken at random in the population would share the same repeat numbers at these four regions was about 1 in 50,000.

Now, the number of known repeat sequences has expanded greatly, with the latest test looking at 24 STR regions. Using all of the known STR regions results in an infinitesimally small probability that any two random people have the same DNA profile. And herein lies the power of DNA profiling.

A knife on the ground with the number five on a yellow card in the background
Swabbing an item left at a crime scene can easily yield enough cells to generate a DNA profile.
Fuss Sergey/Shutterstock

How is DNA profiling performed?

The repeat sequence will be the same in every cell within a person – thus, the DNA profile from a blood sample will be the same as from a plucked hair, inside a tooth, saliva, or skin. It also means a DNA profile will not in itself indicate from what type of tissue it originated.

Consider a knife alleged to be integral to an investigation. A question might be “who held the knife”? A swab (cotton or nylon) will be moistened and rubbed over the handle to collect any cells present.

The swab will then be placed in a tube containing a cocktail of chemicals that purifies the DNA from the rest of the cellular material – this is a highly automated process. The amount of DNA will then be quantified.

If there is sufficient DNA present, we can proceed to generate a DNA profile. The optimum amount of DNA needed to generate the profile is 500 picograms – this is really tiny and represents only 80 cells!

A colourful chart on a screen with DNA base code underneath
DNA profiling relies on finding repeated sequences in a sample.
fotohunter/Shutterstock

How foolproof is DNA profiling?

DNA profiling is highly sensitive, given it can work from only 80 cells. This is microscopic: the tiniest pinprick of blood holds thousands of blood cells.

Consider said knife – if it had been handled by two people, perhaps including a legitimate owner and a person of interest, yet only 80 cells are present, those 80 cells would not be from only one person but two. Hence there is now a less-than-optimal amount of DNA from either of the people, and the DNA profiling will be a mixture of the two.

Fortunately, there are several types of software to pull apart these mixed DNA profiles. However, the DNA profile might be incomplete (the term for this is “partial”); with less DNA data, there will be a reduced power to identify the person.

Worse still, there may be insufficient DNA to generate any meaningful DNA profile at all. If the sensitivity of the testing is pushed further, we might obtain a DNA profile from even a few cells. But this could implicate a person who may have held the knife innocently weeks prior to an alleged event; or be from someone who shook hands with another person who then held the knife.

This later event is called “indirect transfer” and is something to consider with such small amounts of DNA.




Read more:
Criminals can’t easily edit their DNA out of forensic databases


What can’t DNA profiling do?

In forensics, using DNA means comparing a profile from a sample to a reference profile, such as taken from a witness, persons of interest, or criminal DNA databases.

By itself, a DNA profile is a set of numbers. The only thing we can figure out is whether the owner of the DNA has a Y-chromosome – that is, their biological sex is male.

A standard STR DNA profile does not indicate anything about the person’s appearance, predisposition to any diseases, and very little about their ancestry.

Other types of DNA testing, such as ones used in genealogy, can be used to associate the DNA at a crime scene to potential genetic relatives of the person – but current standard STR DNA profiling will not link to anyone other that perhaps very close relatives – parents, offspring, or siblings.

DNA profiling has been, and will continue to be, an incredibly powerful forensic test to answer “whose biological material is this”? This is its tremendous strength. As to how and when that material got there, that’s for different methods to sort out.




Read more:
New technology lets police link DNA to appearance and ancestry – and it’s coming to Australia


The Conversation

Adrian Linacre receives funding from the Attorney General’s Department of South Australia

ref. DNA is often used in solving crimes. But how does DNA profiling actually work? – https://theconversation.com/dna-is-often-used-in-solving-crimes-but-how-does-dna-profiling-actually-work-191937

How the Bali bombings transformed our relations with Indonesia

Source: The Conversation (Au and NZ) – By Tim Lindsey, Malcolm Smith Professor of Asian Law and Director of the Centre for Indonesian Law, Islam and Society, The University of Melbourne

An hour before midnight, 20 years ago, a young Indonesian man walked into Paddy’s Pub, a nightclub in the heart of Bali’s party district of Kuta, and detonated a backpack laden with explosives. Seconds later, a massive car bomb exploded outside the Sari Club across the road.

The impact was devastating. Paddy’s Pub and the Sari Club were destroyed, along with surrounding buildings. In all, 202 people died, but 88 Australian tourists and 38 Indonesian residents and workers were the largest groups. More than 200 more were also badly injured.

It soon became clear the attack was the work of militant Islamists. Indonesian authorities quickly focused on Jemaah Islamiyah, a group that, two years earlier, had been involved in a series of coordinated bombings of churches across Indonesia on Christmas Eve.

Evidence eventually emerged that Al Qaeda had helped fund the attack, through an Indonesian, Riduan Isamuddin, known as Hambali, now a long-term inmate of Guantanamo Bay. But the roots of militant Islamist violence in Indonesia are much older than Al Qaeda. They can be traced back at least to Darul Islam, an Islamist militia that began a long-running war against the Indonesian republic in the late 1940s. Jemaah Islamiyah split from Darul Islam in the 1990s.




Read more:
Remembering the Bali bombings ten years on


How the bombings drew Australia and Indonesia closer

At first, it wasn’t clear how the bombings in Kuta would affect relations between Australia and Indonesia. Then-Australian Foreign Minister Alexander Downer has spoken of his fear the bombings would drive a wedge between the two countries, with the public in each blaming the other.

Instead, the bombings – for both countries, their largest loss of life in a single terrorist attack – drew the two nations together, despite the deep rift created by Australia’s involvement in the secession of East Timor in 1999.

The bombings sparked unprecedented political, security and aid cooperation, with leaders of the two countries feeling they faced a common foe. This only deepened as Jemaah Islamiyah continued its bombing campaign. It targeted upmarket Western hotels in Jakarta and even the Australian Embassy in 2004 before striking again in Bali in 2005.

Australian and United States support helped to fund the establishment of the Indonesian Police’s effective, if controversial, counter-terrorism unit, “Special Detachment 88” (Densus 88). Many members of the Australian Federal Police (AFP) later described the relationship that developed with Indonesian police as like a “brotherhood”.

Likewise, Australian aid was soon flowing to a range of programs to counter violent extremism in Indonesia. This included a major investment to support reform of Indonesia’s important Islamic education sector, long neglected by Indonesian governments.

Death penalty double standards?

Many members of the Jemaah Islamiyah cell that carried out the Kuta attack were rounded up within weeks. Others escaped, but Indonesian authorities, supported by the AFP, were dogged in their pursuit of Jemaah Islamiyah. For years to come, hundreds of suspects would be hunted and arrested and many killed – sometimes in wild shoot-outs and sieges where Densus 88 seemed to be operating without a rule book.

Abu Bakar Ba’asyir, the “spiritual leader” of Jemaah Islamiyah and a long-term opponent of the Indonesian state, was eventually convicted of conspiracy in relation to the Bali bombings in 2005. He received only a two-and-a-half year prison sentence, which was quashed by the Supreme Court in 2006 (although he was jailed for 15 years on another charge in 2011).

However, less than a year after the bombings, three of the key figures involved were sentenced to death: cell leader Abdul Aziz, the self-styled “Imam Samudra”; the attack coordinator, Ali Ghufron, known as Mukhlas; and his brother, Amrozi bin Haji Nurhasyim.

Then-Prime Minister John Howard was quick to endorse the executions saying it would be an “injustice” if they didn’t proceed. His eventual successor, Labor leader Kevin Rudd, agreed the three men deserved their fate.

Amrozi became infamous in the West for seeming to greet what he saw as impending martyrdom with enthusiasm. But all three perpetrators wrote or recorded unrepentant justifications for the bombings. Like Osama bin Laden, they saw terrorism as legitimate revenge for “Western aggression” against Muslims in a global holy war.

Despite this, the three men eventually lodged appeals and a constitutional challenge in attempts to overturn their sentences. These failed, and in the early hours of November 9 2008, they were shot dead by a firing squad on the prison isle of Nusa Kambangan.




Read more:
Bali Nine: hypocrisy, politics and courts play out in death row lottery


The support of Australian leaders for these executions was to backfire when Australian Bali Nine drug smugglers, Myuran Sukumaran and Andrew Chan, were sentenced to death in 2006.

Determined Australian efforts to have their sentences commuted to life attracted global support, including from the UN Secretary General. But they were rejected in Jakarta as hypocritical and evidence of an Australian “double standard”, with the two men facing the firing squad on Nusa Kambangan on April 29 2015.

Their deaths were, in some ways, an unforeseen consequence of the close cooperation between Australian and Indonesian police triggered by the Bali bombings. It was the decision of the AFP to tip off the Indonesian police that led to the arrest of the Bali Nine in Indonesia, rather than on return to Australia.

Protocols have now been introduced to prevent Australians being exposed to the death penalty in this way.

A gradual weakening

As the Jemaah Islamiyah bombings became more distant, the partnership between Australian and Indonesian law enforcement authorities gradually weakened. This was in part because some Indonesians felt Australia wanted too much credit for its role in the crushing of Jemaah Islamiyah.

Even so, other events inevitably also created tensions in the relationship. As well as the fate of Sukumaran and Chan, these included Australian policy on refugees, the decision of the Gillard government to halt live cattle exports to Indonesia due to mistreatment there, and revelations Australia tapped the phones of President Susilo Bambang Yudhoyono and his wife.

Likewise, a series of savage aid cuts under the Abbott government saw Australia suddenly walk away from Islamic education in Indonesia, to the dismay of many Muslim reformers.




Read more:
Jokowi’s visit shows the Australia-Indonesia relationship is strong, but faultlines remain


Today, relations between Australia and Indonesia are more distant. Jemaah Islamiyah no longer seems a serious threat, but Islamist militants certainly remain. For Indonesian authorities, Darul Islam and the groups that emerge from it are a part of the political landscape, and have been since the republic was founded in the 1940s. They see them as a relatively minor threat, but one they expect to persist.

For Australia, the Bali bombings were the moment Al Qaeda’s war on the US and its allies reached us, albeit offshore in the nation’s favourite holiday resort. However, for governments here, the “War on Terror” is now being displaced by other security priorities, including the rise of the home-grown far-right.

But while it may be true that Jemaah Islamiyah’s Bali bombings are fast becoming history, that will never be the case for the many survivors in both countries. They continue to live with the consequences every day.

The Conversation

Tim Lindsey has in the past received funding from the Australian Research Council and various federal government departments.

ref. How the Bali bombings transformed our relations with Indonesia – https://theconversation.com/how-the-bali-bombings-transformed-our-relations-with-indonesia-192011

20 years after the Bali bombings, survivors are still processing a unique kind of grief

Source: The Conversation (Au and NZ) – By Garry Stevens, Director of Humanitarian and Development Studies, Western Sydney University

Bali bombings commemorative mural at Bondi Beach, Sydney. Droogie, Author provided

Today marks the 20th anniversary of the 2002 Bali bombings, which killed 202 people, including 88 Australians – our largest single loss of life from an act of terror.

But we hear less about the wider group of close family members and friends of people who died.

Twenty years on, these people are facing life without their loved ones and dealing with the way they were taken away.




Read more:
Some survivors will find peace and healing in Bali 2002 – but others may find the series triggering


Grief after terrorism is different

Grief specialists describe grieving like a form of storytelling, a process by which we make sense of the loss and what the change means for our lives.

A key part is to connect the news of their passing with the many memories and routines that involved them. This “sorting” process can take months or years but is one way we move to a new story while also staying connected to them.

Losing a loved one in traumatic circumstances can interfere with these processes and lead to persistent or prolonged grief that does not ease over time.

Deaths that are sudden, violent and affect close relationships fall into this category. Reminders of the death can trigger traumatic memories for those left behind.

Terrorism has the further dimension of being both calculated and quite random in its impacts. It leaves survivors struggling to make sense of why this horror affected them.




Read more:
Remembering the Bali bombings ten years on


What we found

Our interviews with Bali survivors eight years after the attacks found those physically injured or experiencing prolonged grief had the highest levels of distress.

Early steps in bereavement generally involve accepting the reality of the loss, partly by allowing yourself to experience the pain of the loss and being able to draw new connections and meaning.

However, after someone is harmed through violence, loved ones can avoid thinking about the loss. This can limit their ability to separate the life lost from how they died.

Over time, the two may “fuse” together, where thoughts about loved ones raise distress about what they experienced. So close family and friends can avoid reminiscing and the usual processing of grief.




Read more:
There’s not always ‘closure’ in the never-ending story of grief


Can anniversaries trigger distress?

The 20th anniversary is similar to other commemorations Bali survivors have worked through in the past two decades.

Many have learned to control or reduce their emotional triggers and are more likely to reflect upon and celebrate their loved ones than dwell upon the terrorism event itself.

At the same time, traumatic grief can last for decades, and most people do not receive effective treatment.

These people remain vulnerable to such triggers, particularly news that is unexpected or presents graphic detail.




Read more:
Is it wrong to make a film about the Port Arthur massacre? A trauma expert’s perspective


How best to support survivors psychologically?

Strong support networks and having people to confide in are critical to recovery.

Our study found married or partnered participants had the lowest levels of distress. Support that was non-judgmental and allowed “time and space” was also most valued, whether or not that came from a partner.

One family member told us what was important was:

People being there for you, where you are that day, and not telling you what to do or how to feel.

For others, working with authorities early on to get clear details of what happened brought some understanding and comfort. One person who lost several friends told us:

For me, it was being able to know the circumstances of their death.

Psychological “talk” therapies such as cognitive behavioural therapy are effective in up to 69% of cases of prolonged grief.

A key approach involves deliberate exposure to distressing thoughts and images related to their loved one’s death but in a safe and structured environment. This allows distress and trigger reactions to be reduced in a controlled way. Ultimately, this can support people to accept the loss.

One study participant told us:

I believe you should try and accept it, which is very hard, but if you don’t it is very difficult to get over it.

Memorial sites are important too

Memorial sites also have an important role. These are a focal point for support networks and rituals, helping to create new memories of their loved ones, based in the present.

Chloe Byron mural Frangipani Girl
‘Frangipani Girl’ Chloe Byron died in Bali at the age of 15.
Droogie/Peter Carette, Author provided

The mural “Frangipani Girl” is a well-known example at Sydney’s Bondi Beach.

The mural is a celebration of the life of Chloe Byron, who died in Bali at the age of 15.

It also represents the journey through grief and renewal her father Dave has undertaken. He said in a podcast interview:

Every day I’ve got a choice between a happy memory of Chloe over the memory of her tragic death […] it’s the choice between a great day and a terrible one.


If this article has raised issues for you, or if you’re concerned about someone you know, call Lifeline on 13 11 14. You can also talk to a counsellor 24/7 at Beyond Blue.

The Conversation

Garry Stevens received funding from the Australian Research Council

ref. 20 years after the Bali bombings, survivors are still processing a unique kind of grief – https://theconversation.com/20-years-after-the-bali-bombings-survivors-are-still-processing-a-unique-kind-of-grief-191512

Some GPs just keep their heads above water. Other doctors’ businesses are more profitable than law firms

Source: The Conversation (Au and NZ) – By Anthony Scott, Professor of Health Economics, The University of Melbourne

Sonny Sixteen/Pexels, CC BY-SA

Almost all GPs and most non-GP specialist doctors (such as cardiologists, gynaecologists and dermatologists) run private businesses to provide medical care in Australia. Business decisions can influence the costs of medical care, the care patients receive, and access to medical care in different geographic areas.

But until now, we’ve had no national data on the costs or profitability of running a private medical practice.

Our ANZ-Melbourne Institute Health Sector Report, out today, uses data from the Australian Bureau of Statistics on all medical businesses in Australia.

We examined trends in growth, costs and profitability, and how the financial health of doctors’ businesses has been affected during the COVID pandemic.

Among our findings, we show how medical businesses, in particular for non-GP specialists, remain very profitable compared to other businesses, including law, accountancy and finance.




Read more:
How much?! Seeing private specialists often costs more than you bargained for


Why should we care about medical businesses?

Many people seeking health care do not think about the costs involved, or the profitability of, running a private medical practice.

But the sudden closure of GP practices for financial reasons reduces access to health care for communities. For others, a focus on seeking profits means out-of-pocket costs can rise.

There are also more widespread reports of reduced access to bulk billing (where there are no out-of-pocket costs).

So how doctors run their private businesses is very much in the public interest.




Read more:
Health worker burnout and ‘compassion fatigue’ put patients at risk. How can we help them help us?


The growth of private practice

It was not too long ago that GPs and non-GP specialists worked largely on their own. But the benefits of working with others has led to a growth in private group medical practice.

GPs were the first doctors to do this. Now almost 90% of GPs report working in a group practice. But other specialists are rapidly catching up, where almost 70% now work in a private group practice.

The total number of doctors in a solo private practice has fallen by 0.5% between 2013 and 2020, while the number in group private practices has increased by 28.9%.

Patient talking to doctor receptionist or health staff behind desk
Groups practices can keep costs down by sharing the costs of premises, administration and support staff.
Cedric Fauntleroy/Pexels, CC BY-SA

Group practices can be good in keeping costs down by sharing the costs of premises, administration, nurses, and medical equipment. Working together can improve the quality of care and access to health care, as patients can easily see another GP in the practice if their preferred one is too busy. In a group practice, doctors can also more easily share knowledge.

But if businesses get too big, this could mean less choice for patients looking for a local doctor, and less competition. This could further increase out-of-pocket costs as there is less competitive pressure to keep fees low.

While more non-GP specialists are working in group private practice, they are also on average spending less time there. In 2020 they spent about three hours per week less in private practice compared to 2013.




Read more:
Last year, half a million Australians couldn’t afford to fill a script. Here’s how to rein in rising health costs


Rising profits and costs

We show profits rose by an average of 2.4% a year for GP businesses and 5.3% a year for non-GP specialists businesses between 2005-6 and 2020-21.

Costs for GPs rose by an average 2.7% a year over the same time period. Turnover from total fees charged grew by 2.9%.

For non-GP specialists costs rose by an average 2% a year over the same time period, while turnover grew by 3.5%.

Overall the growth in costs for GP businesses was higher than for other specialists, and the growth in turnover was lower. This gap between costs and turnover has grown over time.

Non-GP specialists’ businesses made 50% more profit than GP businesses in 2020-21 ($216,468 and $144,485), compared to 14% more in 2005-6 ($120,452 and $105,924).




Read more:
We need more than a website to stop Australians paying exorbitant out-of-pocket health costs


Impact of COVID

Medicare coverage of telehealth meant GPs avoided losing income from the fall in face-to-face visits because of COVID. So revenue from fees continued to increase, though at a lower rate than before 2020.

Medical practices could also claim JobKeeper payments to maintain employment of practice staff. This financial support meant the number of GP and non-GP specialist businesses winding up or going bust actually fell during 2019-20. In fact, the total number of medical businesses continued to grow throughout the pandemic.

Profits initially fell during COVID by 1.9% for GPs and by 4.5% for non-GP specialists between 2018-19 and 2019-20.

But profits bounced back the following year because of the pent-up demand during the pandemic. People who were avoiding health care because of COVID or who had their elective surgeries cancelled, came back and still needed care.

Two surgeons operating
People who once had their elective surgeries cancelled can now go ahead.
Павел Сорокин/Pexels, CC BY-SA

This was especially the case for non-GP specialists, where profits grew by 10.8% between 2019-20 and 2020-21 compared to 2.2% for GPs.

However, medical businesses, especially GPs, experienced sudden increases in costs as they adapted to COVID settings. For GP businesses, costs increased by over 8% during the pandemic (4.1% between 2018-19 and 2019-20, and by 4% between 2019-20 and 2020-21.

It is expected demand will remain high for private medical care provided by GPs and non-GP specialists as people who delayed care and treatment during the pandemic return to seek care.

In fact, medical businesses, especially non-GP specialists, remain very profitable compared to other businesses such as law, accountancy, finance, construction and agriculture. In 2021, the median gross profit per business (turnover minus costs before tax) was $216,468 for non-GP specialists, $120,452 for GPs, and $124,431 for legal businesses.

Implications for patients

Achieving good access to high-quality medical care requires medical businesses to be located in areas of need and where out-of-pocket costs are kept to a minimum for low-income populations.

The growth in private group medical practice can mean medical businesses are run more efficiently, with continuing cost pressures leading to the formation of larger medical groups, especially for non-GP specialists.

In most cases maintaining profitability of private medical businesses is necessary to ensure their survival and maintain access to medical care, as long as out-of-pocket costs don’t increase at the same time.

The Conversation

Anthony Scott receives funding from the Australia and New Zealand Banking Group for the annual report series ‘ANZ-Melbourne Institute Health Sector Reports’. Professor Scott conducts the data analysis and writes the report.

ref. Some GPs just keep their heads above water. Other doctors’ businesses are more profitable than law firms – https://theconversation.com/some-gps-just-keep-their-heads-above-water-other-doctors-businesses-are-more-profitable-than-law-firms-192163

India’s enormous solar park was meant to help poor communities. But it left the landless stricken

Source: The Conversation (Au and NZ) – By Gareth Bryant, Senior Lecturer in Political Economy, University of Sydney

Community members from Pavagada villages Priya Pillai, Author provided

India, like many other countries, is looking to renewables as an antidote to soaring fossil fuel prices and to tackle climate change. Prime Minister Narendra Modi sees renewables as vital for a “developed India”.

But while renewables are seen as a major positive on a societal scale, these large scale facilities can – if done poorly – make life harder for people who live close to them.

That’s exactly what happened to one of the world’s largest solar installations, India’s Pavagada solar park. The park was meant to offer cheap clean power, avoiding 70 million tonnes of carbon dioxide per year and give an economic boost for a poor area. Our new podcast and research found, sadly, that didn’t all happen. Larger landowners profited, while poorer villagers lost access to agricultural land.

The problems of Pavagada show us the importance of genuine partnership with the rural communities where wind and solar farms will be built.

pavagada solar farm india
The enormous Pavagada solar park surrounds a number of villages.
Google Earth, Author provided

The Pavagada model was meant to be win-win

In November 2019, we were in a dusty village in the southern state of Karnataka. Earlier that year, the truly enormous 2 gigawatt Pavagada solar park had begun operating. There were so many solar panels that the five villages in the area were surrounded.

As we were talking with local women outside a small house, more and more people overheard our conversation and joined in. When the discussion became heated, our informants took us inside. “We want to tell you our story,” one said.

Though the house backed onto the solar park, it was dimly lit by only a single lightbulb. Over tea, we asked the women why talking about the solar park had brought up so much tension. One said:

The solar park did not help us. Work should be provided to all educated girls … The priority should be for landless people because the landowning people at least got the lease amount.

They told us that the project was a story of broken promises. Rather than providing solutions to local problems, the solar park had made things worse. Many had lost their livelihoods as farm workers, since the solar panels now covered agricultural land. By contrast, solar companies, government electricity distributors and larger landowners had profited greatly.

women pavagada india
The women of Thirumani and surrounding villages wanted their story of broken promises to be told.
Priya Pillai, Author provided

This was a shock to us. It wasn’t supposed to be this way. The Pavagada solar park was pitched as a flagship of India’s energy transition, able to generate as much power at peak times as a large coal-fired power station.

Worse, Pavagada was meant to be a role-model for ethical renewable energy development in emerging economies.

That’s because it relied on an innovative system of land leasing. The government authority created to oversee the project signed long-term leases with over 1,000 local farmers to obtain the land for the solar park.

These voluntary leases were meant to give farmers a new source of income, which many needed as they struggled to eke out a living amid worsening drought. Solar developers would get the scale they needed and overcome the common bottleneck of small-scale land holdings. And the leases would be achieved without the common land grabbing controversies plaguing large infrastructure projects in India for decades.




Read more:
A tale of two climate policies: India’s UN commitments aim low, but its national policies are ambitious – here’s why that matters


So what went wrong?

The model of the future ran into problems of the present. Our five years of interviews and fieldwork with village women, community representatives, farmers, local government officals, solar company managers, and renewable energy authorities clearly showed the Pavagada model wasn’t distributing benefits evenly. The energy transition left winners – and losers.

Who won? Larger landowners. Who lost? The landless. Over half of the 10,000 people in the five villages near the park are landless agricultural workers, as is common in much of rural India. Because they do not own land, they receive no income from the leasing model. And with much local farming land leased to the solar park, many landless labourers lost their livelihoods.

Sadly, this was predicted in meticulous detail in an early World Bank report, which warned about the effect on farm workers and the landless before the development began.

farm worker india solar power
A mango farmer who chose not to lease his land.
Priya Pillai, Author provided

The huge project did create some new jobs for local people, mostly temporary employment in grass cutting, panel washing and security. But this work has not fully replaced lost livelihoods.

Those worst affected were more likely to be women, particularly those from lower castes or Adivasi (Indigenous) backgrounds. This is because their financial independence came solely from agricultural income.

Even the landowners expressed disillusionment. That’s because they could see their former farm workers were struggling.

As one landowner told us:

people who do not have land, no benefit for them. Rather, they have lost their livelihood, as no one calls them for work.

What should we learn for large-scale renewable projects?

Building large-scale renewable energy projects is essential if we are to meet our climate goals. So how can we do it more fairly?

Focus on the communities affected and find ways of making sure profits and jobs make it to those who need it the most. Because of their need for land, solar and onshore wind have to be built in the regions. But this is often where a country’s poorer people live – and where land is a key difference between wealth and poverty.

Pavagada holds a painful lesson. We need renewables urgently. But we must build it alongside the local communities who will host these new power sources. As many community members told us, they were not opposed to solar. What they wanted was a genuine partnership with revenue sharing, sharing of land across solar and agriculture, and more jobs and opportunities. In short, they were calling for a just transition.




Read more:
Regional towns are at risk of being wiped out by the move to net-zero. Here’s their best chance for survival


The Conversation

Gareth Bryant receives funding from the Australian Research Council.

Devleena Ghosh has received funding from the Australian Research Council.

Jake Morcom and Priya P Pillai do not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and have disclosed no relevant affiliations beyond their academic appointment.

ref. India’s enormous solar park was meant to help poor communities. But it left the landless stricken – https://theconversation.com/indias-enormous-solar-park-was-meant-to-help-poor-communities-but-it-left-the-landless-stricken-189789